View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8650_low_48 (Length: 210)
Name: NF8650_low_48
Description: NF8650
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8650_low_48 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 20 - 202
Target Start/End: Original strand, 44461760 - 44461942
Alignment:
| Q |
20 |
gctttggctgctattactacctgcgataattctattcctggaaatgatgatgttttgtctgtcaagagtagaaccttccgcagactcaccaacattgttg |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
44461760 |
gctttggctgctattactacctgcgataattctattcctggaaatgatgatgttttgtctgtcaagagtagaatcttccgcagactcaccaacattgttg |
44461859 |
T |
 |
| Q |
120 |
ttcttattaccagggccttgcctaaacgtacttcttctgtccaaccagtcaaagtgtaatttaaatcatctttgctctctgct |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
44461860 |
ttcttattaccagggccttgcctaaacgtactccttctgcccaaccagtcaaagtgtaatttaaatcatctttgctctgtgct |
44461942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University