View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8651_high_14 (Length: 241)
Name: NF8651_high_14
Description: NF8651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8651_high_14 |
 |  |
|
| [»] scaffold0032 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0032 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: scaffold0032
Description:
Target: scaffold0032; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 11 - 237
Target Start/End: Original strand, 44723 - 44949
Alignment:
| Q |
11 |
tgtcatttattgcttatatgtttcccaactatgataagtttaattaccatgatgcagcatctcccatattcaagcagttggacttctgattttagcagcg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44723 |
tgtcatttattgcttatatgtttcccaactatgataagtttaattaccatgatgtagcatctcccatattcaagcagttggacttctgattttagcagcg |
44822 |
T |
 |
| Q |
111 |
tttaaagaaattcgccatcgatcaggaaaatatatcttgaagtactgccctagtatcagagtcctgtatnnnnnnnnnnnnnnnnnnagctgttggatga |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
44823 |
tttaaagaaattcgccatcgatcaggaaaatatatcttgaagtactgccctagtatcagagtcctgtattcatcatcatcatcatcaagctgttggatga |
44922 |
T |
 |
| Q |
211 |
agtatgggattgttgtgatgtccatct |
237 |
Q |
| |
|
||||||||||||||||||||| ||||| |
|
|
| T |
44923 |
agtatgggattgttgtgatgttcatct |
44949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University