View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8651_high_16 (Length: 232)
Name: NF8651_high_16
Description: NF8651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8651_high_16 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 214
Target Start/End: Complemental strand, 37935180 - 37934971
Alignment:
| Q |
1 |
atttccgcaatcaattcgttggggaggaacaatgccgccctcgccaccatagcttgccgttcaagttaaaccctagctacccacccagccaccgttccaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
37935180 |
atttccgcaatcaattcgttggggaggaacaatgccgccctcgccaccatagcttgccgttcaagttaaaccctagctaccca----gccaccgttccaa |
37935085 |
T |
|
| Q |
101 |
agttaattgagaaaggaaaaggataatttacgtcacatggttcttcatttgcacctttaggtacatcaagattgttctcaactacctgaacctgaaacat |
200 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37935084 |
agctaattgagaaaggaaaaggataatttacgtcacatggttcttcatttgcacctttaggtacatcaagattgttctcaactacctgaacctgaaacat |
37934985 |
T |
|
| Q |
201 |
cgcaacacaatcac |
214 |
Q |
| |
|
||||||| |||||| |
|
|
| T |
37934984 |
cgcaacataatcac |
37934971 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 58; Significance: 2e-24; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 108 - 213
Target Start/End: Complemental strand, 845418 - 845313
Alignment:
| Q |
108 |
tgagaaaggaaaaggataatttacgtcacatggttcttcatttgcacctttaggtacatcaagattgttctcaactacctgaacctgaaacatcgcaaca |
207 |
Q |
| |
|
|||||||||| || |||||||||||||||| ||||||||| ||| ||||||||| |||||||||||||||||| |||||||||||| ||| |||||| |
|
|
| T |
845418 |
tgagaaaggacaaagataatttacgtcacagggttcttcaggagcatctttaggtatatcaagattgttctcaacatcctgaacctgaagcattgcaaca |
845319 |
T |
|
| Q |
208 |
caatca |
213 |
Q |
| |
|
|||||| |
|
|
| T |
845318 |
caatca |
845313 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 106 - 179
Target Start/End: Complemental strand, 10455917 - 10455845
Alignment:
| Q |
106 |
attgagaaaggaaaaggataatttacgtcacatggttcttcatttgcacctttaggtacatcaagattgttctc |
179 |
Q |
| |
|
||||||||||||||| | |||||||| ||||| ||||||||||||| | |||||| |||||||||| ||||||| |
|
|
| T |
10455917 |
attgagaaaggaaaaag-taatttacatcacacggttcttcatttgtatctttagttacatcaagactgttctc |
10455845 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University