View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8651_high_18 (Length: 221)
Name: NF8651_high_18
Description: NF8651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8651_high_18 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 89; Significance: 5e-43; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 57 - 197
Target Start/End: Complemental strand, 4964627 - 4964487
Alignment:
| Q |
57 |
gttaaatcatatctctttctctgtgatgctatgctactaacttcttcacccctgtgttacttccattattacatgaaagccattttta--cactctgaat |
154 |
Q |
| |
|
|||||||| |||||||||||||||||| ||| ||||||||||||||||||||||| |||||||||||||||||||| ||||| |||| ||| |||||| |
|
|
| T |
4964627 |
gttaaatcctatctctttctctgtgatacta--ctactaacttcttcacccctgtgctacttccattattacatgaaggccatctttatacacactgaat |
4964530 |
T |
 |
| Q |
155 |
tatcagataaattcaactatcttttttaactttttcccataag |
197 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4964529 |
ttgcagataaattcaactatcttttttaactttttcccataag |
4964487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 60; Significance: 9e-26; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 142 - 205
Target Start/End: Complemental strand, 25220624 - 25220561
Alignment:
| Q |
142 |
ttacactctgaattatcagataaattcaactatcttttttaactttttcccataaggtgtgttt |
205 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25220624 |
ttacactctgaattgtcagataaattcaactatcttttttaactttttcccataaggtgtgttt |
25220561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University