View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8651_high_5 (Length: 328)
Name: NF8651_high_5
Description: NF8651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8651_high_5 |
 |  |
|
| [»] scaffold0287 (1 HSPs) |
 |  |  |
|
| [»] scaffold0402 (1 HSPs) |
 |  |  |
|
| [»] scaffold0008 (1 HSPs) |
 |  |  |
|
| [»] scaffold0595 (1 HSPs) |
 |  |  |
|
| [»] scaffold0778 (1 HSPs) |
 |  |  |
|
| [»] scaffold0432 (1 HSPs) |
 |  |  |
|
| [»] scaffold0013 (1 HSPs) |
 |  |  |
|
| [»] scaffold0515 (1 HSPs) |
 |  |  |
|
| [»] scaffold0306 (1 HSPs) |
 |  |  |
|
| [»] scaffold0882 (1 HSPs) |
 |  |  |
|
| [»] scaffold0002 (1 HSPs) |
 |  |  |
|
| [»] scaffold0179 (1 HSPs) |
 |  |  |
|
| [»] scaffold0061 (1 HSPs) |
 |  |  |
|
| [»] scaffold0244 (1 HSPs) |
 |  |  |
|
| [»] scaffold0024 (1 HSPs) |
 |  |  |
|
| [»] scaffold0457 (1 HSPs) |
 |  |  |
|
| [»] scaffold0163 (2 HSPs) |
 |  |  |
|
| [»] scaffold0014 (1 HSPs) |
 |  |  |
|
| [»] scaffold0057 (1 HSPs) |
 |  |  |
|
| [»] scaffold0364 (1 HSPs) |
 |  |  |
|
| [»] scaffold0502 (1 HSPs) |
 |  |  |
|
| [»] scaffold0122 (1 HSPs) |
 |  |  |
|
| [»] scaffold0041 (1 HSPs) |
 |  |  |
|
| [»] scaffold0010 (1 HSPs) |
 |  |  |
|
| [»] scaffold0131 (1 HSPs) |
 |  |  |
|
| [»] scaffold0684 (1 HSPs) |
 |  |  |
|
| [»] scaffold0070 (1 HSPs) |
 |  |  |
|
| [»] scaffold0242 (2 HSPs) |
 |  |  |
|
| [»] scaffold0548 (2 HSPs) |
 |  |  |
|
| [»] scaffold0160 (1 HSPs) |
 |  |  |
|
| [»] scaffold0204 (1 HSPs) |
 |  |  |
|
| [»] scaffold0036 (1 HSPs) |
 |  |  |
|
| [»] scaffold0795 (1 HSPs) |
 |  |  |
|
| [»] scaffold0223 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0287 (Bit Score: 92; Significance: 1e-44; HSPs: 1)
Name: scaffold0287
Description:
Target: scaffold0287; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 63 - 184
Target Start/End: Complemental strand, 1188 - 1070
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| |||||||| ||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1188 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccgg---atgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
1092 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
1091 |
agtttataatggctttgccatt |
1070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 92; Significance: 1e-44; HSPs: 126)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 63 - 184
Target Start/End: Complemental strand, 3497647 - 3497529
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| |||||||| ||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3497647 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccgg---atgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
3497551 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
3497550 |
agtttataatggctttgccatt |
3497529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 84; E-Value: 7e-40
Query Start/End: Original strand, 63 - 184
Target Start/End: Original strand, 4106552 - 4106670
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| |||||||| |||| |||||| ||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
4106552 |
tatccagaagtcctagctcaactggtaaaatgccgaaattgttaggccgg---atgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtg |
4106648 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
4106649 |
agtttataatggctttgccatt |
4106670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 61 - 184
Target Start/End: Complemental strand, 35157216 - 35157096
Alignment:
| Q |
61 |
tatatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtg |
160 |
Q |
| |
|
||||||||||||| |||||||| ||||||||||| ||||||||||||||||| ||| |||||||||||||||||||| ||||||||||||| |||||| |
|
|
| T |
35157216 |
tatatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccgg---atgtcatgaccggggttcgaaccccggtacctccacttatgtgtg |
35157120 |
T |
 |
| Q |
161 |
tgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||||| |||| |
|
|
| T |
35157119 |
tgagtttataatggctttgccatt |
35157096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 62 - 184
Target Start/End: Complemental strand, 4069247 - 4069128
Alignment:
| Q |
62 |
atatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgt |
161 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| ||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
4069247 |
atatccagaagtcctaactcaactggcaaaataccgaaattgttaggccgg---atgccatgaccggggttcgaaccccggtacctccacttgtgtgtgt |
4069151 |
T |
 |
| Q |
162 |
gagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||||| |||| |
|
|
| T |
4069150 |
gagtttataatggctttgccatt |
4069128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 63 - 184
Target Start/End: Complemental strand, 4887643 - 4887525
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| |||||||| ||||||||||| ||||||||||||||||| |||||||||||| ||||||||||||| ||| |||||||||||||||| |
|
|
| T |
4887643 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccgg---atgccatgaccgaggttcgaaccctgatacatccacttgtgtgtgtg |
4887547 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
4887546 |
agtttataatggctttgccatt |
4887525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 63 - 184
Target Start/End: Original strand, 17895632 - 17895750
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||| ||||| |||||||| ||||||||||| |||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
17895632 |
tatcctgaagtcctagctcaactggcaaaatgctgaaattgttaggccgg---atgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtg |
17895728 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
17895729 |
agtttataatggctttgtcatt |
17895750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 63 - 184
Target Start/End: Original strand, 35849293 - 35849411
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| |||||||| |||||||| || ||||||||||||||||| |||||||||||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
35849293 |
tatccagaagtcctagctcaactggcaaagtgccgaaattgttaggccgg---atgccatgaccggggttcgaaccccggtacctctacttgtgtgtgtg |
35849389 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
35849390 |
agtttataatggctttgccatt |
35849411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 79; E-Value: 7e-37
Query Start/End: Original strand, 64 - 184
Target Start/End: Complemental strand, 10061145 - 10061028
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
||||| |||| |||||||| ||||||||||| ||||||||||||||||| ||||||||||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
10061145 |
atccacaagtcctagctcaactggcaaaatgccgaaattgttaggccgg---atgccatgaccggggttcgaatcccggtacctccacttgtgtgtgtga |
10061049 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
10061048 |
gtttataatggctttgccatt |
10061028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 79; E-Value: 7e-37
Query Start/End: Original strand, 63 - 179
Target Start/End: Complemental strand, 47584801 - 47584688
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||| ||||||||||||| |||||||||||||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
47584801 |
tatccagaagtcctagctcaactggcaaaatgtcgacattgttaggccgg---atgccatgaccggggttcgaaccccggtacctccacttatgtgtgtg |
47584705 |
T |
 |
| Q |
163 |
agtttataatggctttg |
179 |
Q |
| |
|
|||||||||||| |||| |
|
|
| T |
47584704 |
agtttataatggttttg |
47584688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 79; E-Value: 7e-37
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 48612516 - 48612633
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| ||||||||||| ||||||||||||||||| |||||||||||||||||||||||| ||||||| ||||| ||||||||| |
|
|
| T |
48612516 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccgg---atgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
48612612 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
48612613 |
gtttataatggctttgccatt |
48612633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 63 - 178
Target Start/End: Complemental strand, 1573971 - 1573859
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| |||||||| |||| |||||| ||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
1573971 |
tatccagaagtcctagctcaactggtaaaatgccgaaattgttaggccgg---atgccatgaccggggttcgaaccccggtacctccacttgtgtgtgta |
1573875 |
T |
 |
| Q |
163 |
agtttataatggcttt |
178 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
1573874 |
agtttataatggcttt |
1573859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 61 - 184
Target Start/End: Original strand, 18944920 - 18945040
Alignment:
| Q |
61 |
tatatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtg |
160 |
Q |
| |
|
||||||||||||| |||| ||| ||||||||||| ||||||||||||||||| || |||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
18944920 |
tatatccagaagtcctagttcaactggcaaaatgccgaaattgttaggccgg---atatcatgaccggggttcgaaccctggtacctccacttatgtgtg |
18945016 |
T |
 |
| Q |
161 |
tgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||||| |||| |
|
|
| T |
18945017 |
tgagtttataatggctttgccatt |
18945040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 56 - 184
Target Start/End: Original strand, 40013254 - 40013380
Alignment:
| Q |
56 |
taatttatatccagaagttctagctcagctggcaaaa-tgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttg |
154 |
Q |
| |
|
||||| |||||||||||| |||||||| ||| ||||| || ||||||||||||||||| |||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
40013254 |
taattaatatccagaagtcctagctcaactgacaaaaatgccgaaattgttaggccgg---atgccatgaccgaggttcgaaccccggtacctccacttg |
40013350 |
T |
 |
| Q |
155 |
tgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||||||||||| |||| |
|
|
| T |
40013351 |
tgtgtgtgagtttataatggctttgccatt |
40013380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 63 - 184
Target Start/End: Original strand, 45236928 - 45237046
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| |||||||| ||||||||||| ||||||||||||||||| ||| |||||||||||||||||||| | ||||||||||||||| |||| |
|
|
| T |
45236928 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccgg---atgtcatgaccggggttcgaaccccgatacctccacttgtgtatgtg |
45237024 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
45237025 |
agtttataatggctttgccatt |
45237046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 64 - 184
Target Start/End: Complemental strand, 3861465 - 3861348
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||| | | ||||||||||||||||||||||||||||| ||| ||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3861465 |
atccagaagtcctagtttaactggcaaaatgtcgaaattgttaggccgg---atgtcatgatcggggttcgaaccccggtacctccacttgtgtgtgtga |
3861369 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
3861368 |
gtttataatggctttgccatt |
3861348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 76 - 184
Target Start/End: Original strand, 5508696 - 5508801
Alignment:
| Q |
76 |
tagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggc |
175 |
Q |
| |
|
||||||| ||||||||||| ||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||| |
|
|
| T |
5508696 |
tagctcaactggcaaaatgccgaaattgttaggccgg---atgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttgtaatggc |
5508792 |
T |
 |
| Q |
176 |
tttggcatt |
184 |
Q |
| |
|
|||| |||| |
|
|
| T |
5508793 |
tttgccatt |
5508801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 19306711 - 19306828
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| ||||||||||| ||||||| ||||||||| |||||||||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
19306711 |
atccagaagtcctagctcaactggcaaaatgccgaaattattaggccgg---atgccatgaccggggttcgaaccccggttcctccacttgtgtgtgtga |
19306807 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||| |||||| |||| |
|
|
| T |
19306808 |
gtttataatagctttgccatt |
19306828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 31717296 - 31717413
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| |||| |||||| ||||||||||||||||| |||||||||||||||||||||| | ||||||||||||| ||||||||| |
|
|
| T |
31717296 |
atccagaagtcctagctcaactggtaaaatgccgaaattgttaggccgg---atgccatgaccggggttcgaactccggtacctccacttatgtgtgtga |
31717392 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
31717393 |
gtttataatggctttgccatt |
31717413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 40809044 - 40809161
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| ||||||||||| |||| |||||||||||| ||| ||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
40809044 |
atccagaagtcctagctcaactggcaaaatgccgaatttgttaggccgg---atgtcatgaccagggttcgaaccctggtacctccacttgtgtgtgtga |
40809140 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||| ||||| |||| |
|
|
| T |
40809141 |
gtttataatgactttgccatt |
40809161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 65 - 184
Target Start/End: Complemental strand, 27396442 - 27396326
Alignment:
| Q |
65 |
tccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgag |
164 |
Q |
| |
|
||||||||| |||||||| ||||||||||| ||||||||||||||||| ||||||||| ||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
27396442 |
tccagaagtcctagctcaactggcaaaatgccgaaattgttaggccgg---atgccatgattggggttcgaaccccggtacctccacttgtgtgtgtgag |
27396346 |
T |
 |
| Q |
165 |
tttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||| |||| |||| |
|
|
| T |
27396345 |
tttataatggttttgccatt |
27396326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 63 - 178
Target Start/End: Original strand, 29151581 - 29151693
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| |||||||| ||||||||||| |||||||||||||||| |||| |||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
29151581 |
tatccagaagtcctagctcaactggcaaaatgctgaaattgttaggccgg---atgctatgatcggggttcgaaccccggtacctccacttgtgtgtgtg |
29151677 |
T |
 |
| Q |
163 |
agtttataatggcttt |
178 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
29151678 |
agtttataatggcttt |
29151693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 60 - 184
Target Start/End: Complemental strand, 40656243 - 40656120
Alignment:
| Q |
60 |
ttatatccagaagttctagctcagctggcaaaa--tgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgt |
157 |
Q |
| |
|
||||||| |||||| |||||||| ||||||||| || ||| ||||||||||||| |||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
40656243 |
ttatatctagaagtcctagctcaactggcaaaaaatgccgatattgttaggccgg---atgccatgaccggggttcgaaccccggtacctccacttgtgt |
40656147 |
T |
 |
| Q |
158 |
gtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||||||||| |||| |
|
|
| T |
40656146 |
gtgtgagtttataatggctttgccatt |
40656120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 70 - 184
Target Start/End: Original strand, 21226070 - 21226181
Alignment:
| Q |
70 |
aagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttat |
169 |
Q |
| |
|
|||| ||| |||| ||||||||||| ||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
21226070 |
aagtcctatctcaactggcaaaatgccgaaattgttaggccgg---atgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttat |
21226166 |
T |
 |
| Q |
170 |
aatggctttggcatt |
184 |
Q |
| |
|
|||| ||||| |||| |
|
|
| T |
21226167 |
aatgtctttgccatt |
21226181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 75 - 184
Target Start/End: Original strand, 16816701 - 16816807
Alignment:
| Q |
75 |
ctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatgg |
174 |
Q |
| |
|
|||| ||| ||||||||||| ||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
16816701 |
ctagttcaactggcaaaatgccgaaattgttaggccgg---atgccatgaccggggttcgaaccgcggtacctccacttgtgtgtgtgagtttataatgg |
16816797 |
T |
 |
| Q |
175 |
ctttggcatt |
184 |
Q |
| |
|
||||| |||| |
|
|
| T |
16816798 |
ctttgccatt |
16816807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 67 - 184
Target Start/End: Original strand, 19258426 - 19258540
Alignment:
| Q |
67 |
cagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtt |
166 |
Q |
| |
|
||||||| || ||||| || | |||||| ||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
19258426 |
cagaagtcctggctcaactagaaaaatgccgaaattgttaggccgg---atgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtt |
19258522 |
T |
 |
| Q |
167 |
tataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||| |||| |
|
|
| T |
19258523 |
tataatggctttgccatt |
19258540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 63 - 184
Target Start/End: Complemental strand, 37117975 - 37117857
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| |||||||| ||| |||||||| |||||||||||| ||| ||||||||| ||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
37117975 |
tatccagaagtcctagctcaactgacaaaatgttgaaattgttaggtcgg---atgccatgatcggggttcgaatcctggtaactccacttgtgtgtgtg |
37117879 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
37117878 |
agtttataatggctttgtcatt |
37117857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 1323682 - 1323799
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| ||||||||||| |||| |||||||||||| ||| ||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1323682 |
atccagaagtcctagctcaactggcaaaatgccgaatttgttaggccgg---atgtcatgaccagggttcgaacccaggtacctccacttgtgtgtgtga |
1323778 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||| ||||| |||| |
|
|
| T |
1323779 |
gtttataatgactttgccatt |
1323799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 64 - 184
Target Start/End: Complemental strand, 2228209 - 2228092
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||||||||||||||||| ||| ||||||||||||||||| || ||||||||||||||| ||||||| |
|
|
| T |
2228209 |
atccagaagtcgtagctcaactggcaaaatgtcgaaattgttaggccgg---atgtcatgaccggggttcgaatcccggtacctccacttgtatgtgtga |
2228113 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||| ||||| |||| |
|
|
| T |
2228112 |
gtttataatgactttgtcatt |
2228092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 33628027 - 33628144
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| ||| |||| || ||||||||||| ||||| ||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
33628027 |
atccagaagtcctagctcaactgacaaagtgccgaaattgttaagccgg---atgccatgaccagggttcgaaccctggtacctccacttgtgtgtgtga |
33628123 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||| |||| |||| |
|
|
| T |
33628124 |
gtttataatggttttgtcatt |
33628144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 64 - 184
Target Start/End: Complemental strand, 45041862 - 45041745
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| ||||||| ||||||||||| ||||||||||||| ||| ||||| |||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
45041862 |
atccagaagtcttagctcaactggcaaaatgccgaaattgttaggtcgg---atgccttgaccggggttcgaaccccggtacctccacttgtgtgtgtga |
45041766 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||| ||||| |||| |
|
|
| T |
45041765 |
gtttataatgactttgccatt |
45041745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 63 - 184
Target Start/End: Original strand, 9379989 - 9380105
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| |||||||| |||||||||||||||||||||||||| |||||| |||||||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
9379989 |
tatccagaagtcctagctcaactggcaaaatgtcgaaattgttaggc---cggatgtcatgaccggggttcgaaccccagtacctccact--tgtgtgtg |
9380083 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
| ||||||||||||||| |||| |
|
|
| T |
9380084 |
aatttataatggctttgccatt |
9380105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 68 - 184
Target Start/End: Original strand, 1869818 - 1869932
Alignment:
| Q |
68 |
agaagttctagctcagctggcaaaa-tgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtt |
166 |
Q |
| |
|
|||||| |||||||| ||||||||| || ||| ||||||||||||| |||||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
1869818 |
agaagtcctagctcaactggcaaaaatgccgatattgttaggccgg---atgccatgaccggggttcgaactccggtacctccacttgtgtgtgtgagtt |
1869914 |
T |
 |
| Q |
167 |
tataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||| |||| |
|
|
| T |
1869915 |
tataatggctttgccatt |
1869932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 63 - 184
Target Start/End: Complemental strand, 2354927 - 2354807
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccact--tgtgtgtg |
160 |
Q |
| |
|
||||||||||| |||||||| ||||||||||| |||||||||||||| |||||| ||||||||| |||||||||| | |||||||||| |||||||| |
|
|
| T |
2354927 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggc---cggatgtcatgaccggagttcgaaccccgatacctccacttgtgtgtgtg |
2354831 |
T |
 |
| Q |
161 |
tgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||||| |||| |
|
|
| T |
2354830 |
tgagtttataatggctttgccatt |
2354807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 68 - 184
Target Start/End: Original strand, 14817430 - 14817543
Alignment:
| Q |
68 |
agaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagttt |
167 |
Q |
| |
|
|||| |||||||||| |||| |||||||| ||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
14817430 |
agaaattctagctcaactgggaaaatgtcaaaattgttaggccgg---atgccatgatcggggttcgaaccctggtacctccacttgtgtgtatgagttt |
14817526 |
T |
 |
| Q |
168 |
ataatggctttggcatt |
184 |
Q |
| |
|
| |||| ||||| |||| |
|
|
| T |
14817527 |
acaatgactttgtcatt |
14817543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 68 - 184
Target Start/End: Original strand, 15264426 - 15264539
Alignment:
| Q |
68 |
agaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagttt |
167 |
Q |
| |
|
|||| |||||||||| |||| |||||||| ||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
15264426 |
agaaattctagctcaactgggaaaatgtcaaaattgttaggccgg---atgccatgatcggggttcgaaccctggtacctccacttgtgtgtatgagttt |
15264522 |
T |
 |
| Q |
168 |
ataatggctttggcatt |
184 |
Q |
| |
|
| |||| ||||| |||| |
|
|
| T |
15264523 |
acaatgactttgtcatt |
15264539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 63 - 179
Target Start/End: Complemental strand, 37410832 - 37410719
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
|||| |||||| ||||||| ||||||||||| ||||||||||||||||| ||| |||||| ||||||||||||||| |||||||||||||||||||| |
|
|
| T |
37410832 |
tatctagaagtcttagctcaactggcaaaatgccgaaattgttaggccgg---atgtcatgactggggttcgaaccctgatacctccacttgtgtgtgtg |
37410736 |
T |
 |
| Q |
163 |
agtttataatggctttg |
179 |
Q |
| |
|
|||||||||||| |||| |
|
|
| T |
37410735 |
agtttataatggttttg |
37410719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 63 - 178
Target Start/End: Complemental strand, 47086431 - 47086318
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaa-tgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgt |
161 |
Q |
| |
|
|||||| |||| |||||||| ||| ||||| |||||||||||||||||||| ||||||||| |||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
47086431 |
tatccataagtcctagctcaactgacaaaaatgtcgaaattgttaggccgg---atgccatgatcggggttcgaaccctgttacctccacttatgtgtgt |
47086335 |
T |
 |
| Q |
162 |
gagtttataatggcttt |
178 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
47086334 |
gagtttataatggcttt |
47086318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 64 - 184
Target Start/End: Complemental strand, 48729813 - 48729696
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| ||||||||||| ||||||||||||||||| ||| ||||| || |||||||| | ||||||||||||||||||||||| |
|
|
| T |
48729813 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccgg---atgtcatgatcgtggttcgaattccggtacctccacttgtgtgtgtga |
48729717 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
48729716 |
gtttataatggctttgccatt |
48729696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 67 - 178
Target Start/End: Complemental strand, 7312579 - 7312471
Alignment:
| Q |
67 |
cagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtt |
166 |
Q |
| |
|
||||||| |||||||| ||||||||||| | ||||||||||||||| ||| |||||||||||||||||||| ||||||||||||||||||||||| || |
|
|
| T |
7312579 |
cagaagtcctagctcaactggcaaaatgccaaaattgttaggccgg---atgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgaatt |
7312483 |
T |
 |
| Q |
167 |
tataatggcttt |
178 |
Q |
| |
|
||||| |||||| |
|
|
| T |
7312482 |
tataacggcttt |
7312471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 89 - 184
Target Start/End: Original strand, 8946452 - 8946544
Alignment:
| Q |
89 |
aaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||| ||||||||||||||||| |||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
8946452 |
aaaatgccgaaattgttaggccgg---atgccatgaccggggttcgaaccccggtacctccacttgcgtgtgtgagtttataatggctttgccatt |
8946544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 64 - 179
Target Start/End: Original strand, 10422477 - 10422589
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| ||||||| |||||||||| |||||||||||||| ||| ||||||||| ||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
10422477 |
atccagaagtcttagctcaactggcaaaatatcgaaattgttaggtcgg---atgccatgatcggggttcgaatcccggtacctccacttgtgtgtgtga |
10422573 |
T |
 |
| Q |
164 |
gtttataatggctttg |
179 |
Q |
| |
|
||||||||| |||||| |
|
|
| T |
10422574 |
gtttataattgctttg |
10422589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 70 - 184
Target Start/End: Original strand, 33512802 - 33512913
Alignment:
| Q |
70 |
aagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttat |
169 |
Q |
| |
|
|||| |||||||| ||||||||||| ||||||||||||||||| |||| || | ||||||| |||||| ||||||||||||||||||||||||||||| |
|
|
| T |
33512802 |
aagtcctagctcaactggcaaaatgccgaaattgttaggccgg---atgctataatcggggtttgaaccccggtacctccacttgtgtgtgtgagtttat |
33512898 |
T |
 |
| Q |
170 |
aatggctttggcatt |
184 |
Q |
| |
|
|||||||||| |||| |
|
|
| T |
33512899 |
aatggctttgtcatt |
33512913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 67 - 184
Target Start/End: Complemental strand, 4674435 - 4674321
Alignment:
| Q |
67 |
cagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtt |
166 |
Q |
| |
|
||||||| |||||||| ||||||||||| ||||||||||| | | | || |||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
4674435 |
cagaagtcctagctcaactggcaaaatgccgaaattgttaagtcag---atatcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtt |
4674339 |
T |
 |
| Q |
167 |
tataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||| |||| |
|
|
| T |
4674338 |
tataatggctttgccatt |
4674321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 33228698 - 33228816
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaa-tgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
|||||||||| |||||||| ||||||||| |||||||||||||||||||| |||||||||||| ||||||||||| ||||| |||||||||||| ||| |
|
|
| T |
33228698 |
atccagaagtcctagctcaactggcaaaaatgtcgaaattgttaggccgg---atgccatgaccgaggttcgaaccccggtacatccacttgtgtgcgtg |
33228794 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
||||| ||||| ||||| |||| |
|
|
| T |
33228795 |
agtttgtaatgcctttgacatt |
33228816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 6327210 - 6327327
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| ||| |||| ||| ||||||| ||||||||||||||| |||||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
6327210 |
atccagaagtcctaactcaactgacaaaatgcaaaaattgttaggccgg---atgccatgaccggggttcgaaccccggtacatccacttgtgtgtgtga |
6327306 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||| ||||| |||| |
|
|
| T |
6327307 |
gtttataatgactttgccatt |
6327327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 68 - 184
Target Start/End: Original strand, 10166873 - 10166985
Alignment:
| Q |
68 |
agaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagttt |
167 |
Q |
| |
|
|||||| |||||||| ||| |||||| ||||||||||||||||| |||||||||||||| ||||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
10166873 |
agaagtcctagctcaactgataaaatgccgaaattgttaggccgg---atgccatgaccggg-ttcgaactctggtacctccacttgtgtatgtgagttt |
10166968 |
T |
 |
| Q |
168 |
ataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||| |||| |
|
|
| T |
10166969 |
ataatggctttgtcatt |
10166985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 48467810 - 48467926
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||| | |||||||| |||||||||| ||||||||||||| |||| ||| ||||| |||||||||||||||||||||||||||||||||| || |
|
|
| T |
48467810 |
atccagaaatcctagctcaactggcaaaatatcgaaattgttagaccgg---atgttatgac-ggggttcgaaccctggtacctccacttgtgtgtgcga |
48467905 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
48467906 |
gtttataatggctttgtcatt |
48467926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 68 - 184
Target Start/End: Complemental strand, 23789539 - 23789427
Alignment:
| Q |
68 |
agaagttctagctcagctggcaaaa-tgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtt |
166 |
Q |
| |
|
|||||| |||| ||| ||||||||| || ||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
23789539 |
agaagtcctagttcaactggcaaaaatgccgatattgttaggccgg---atgccatgaccggggttcgaaccctggtacctccacttgtg--tgtgagtt |
23789445 |
T |
 |
| Q |
167 |
tataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||| |||| |
|
|
| T |
23789444 |
tataatggctttgccatt |
23789427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 68 - 178
Target Start/End: Original strand, 37919972 - 37920079
Alignment:
| Q |
68 |
agaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagttt |
167 |
Q |
| |
|
|||||| |||||||| |||||||||| |||||||||||||| | | ||||||||||| || ||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
37919972 |
agaagtcctagctcaactggcaaaatatcgaaattgttaggtcag---atgccatgacctggattcgaaccccggtacctccacttatgtgtgtgagttt |
37920068 |
T |
 |
| Q |
168 |
ataatggcttt |
178 |
Q |
| |
|
||||||||||| |
|
|
| T |
37920069 |
ataatggcttt |
37920079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 113 - 184
Target Start/End: Original strand, 4227379 - 4227450
Alignment:
| Q |
113 |
cggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
4227379 |
cggatgccatgatcggggttcgaaccccggtacctccacttgtgtgtgtgagtttataatggctttgccatt |
4227450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 117 - 184
Target Start/End: Complemental strand, 40012068 - 40012001
Alignment:
| Q |
117 |
tgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
40012068 |
tgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataatggctttgccatt |
40012001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 63 - 184
Target Start/End: Original strand, 44327638 - 44327756
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||| | |||||||| ||||||||||||| ||||||||||||||| ||| ||||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
44327638 |
tatccagaattcctagctcaactggcaaaatgtcaaaattgttaggccgg---atgtcatgaccggaattcgaaccccaatacctccacttgtgtgtgtg |
44327734 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||| |||||| |||| |
|
|
| T |
44327735 |
agtttataatagctttgtcatt |
44327756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 68 - 184
Target Start/End: Complemental strand, 38678288 - 38678175
Alignment:
| Q |
68 |
agaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagttt |
167 |
Q |
| |
|
|||||| |||||||| ||||||||||| ||||| |||||| | | ||||||||||||||||| |||||| |||||||||||||||||||||||||| |
|
|
| T |
38678288 |
agaagtcctagctcaattggcaaaatgtagaaatagttaggtcag---atgccatgaccggggtttgaaccccagtacctccacttgtgtgtgtgagttt |
38678192 |
T |
 |
| Q |
168 |
ataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||| |||| |
|
|
| T |
38678191 |
ataatggctttgccatt |
38678175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 62 - 172
Target Start/End: Original strand, 41780260 - 41780365
Alignment:
| Q |
62 |
atatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgt |
161 |
Q |
| |
|
|||||||||||| ||| |||| || ||||||||||||||||||||| | ||||| |||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
41780260 |
atatccagaagtcctaactcaactagcaaaatgtcgaaattgttag---gttggatgtcatgaccggggttcgaaccctggtacctccac--gtgtgtgt |
41780354 |
T |
 |
| Q |
162 |
gagtttataat |
172 |
Q |
| |
|
||||||||||| |
|
|
| T |
41780355 |
gagtttataat |
41780365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 89 - 184
Target Start/End: Complemental strand, 46734220 - 46734128
Alignment:
| Q |
89 |
aaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||||||| || ||| ||||| |||||||||||||| | ||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
46734220 |
aaaatgtcgaaattgttaggctgg---atgtcatgatcggggttcgaaccccgttacctccacttgtgtgtgtgagtttataatggctttgccatt |
46734128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 62 - 184
Target Start/End: Complemental strand, 29628515 - 29628396
Alignment:
| Q |
62 |
atatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgt |
161 |
Q |
| |
|
||||| |||||| |||||||| |||| |||||| ||||||| ||||| ||| ||||||||| | ||||||||| || ||||||||||||||||||||| |
|
|
| T |
29628515 |
atatctagaagtcctagctcaactggaaaaatgccgaaattattaggtcgg---atgccatgatcagggttcgaatcccggtacctccacttgtgtgtgt |
29628419 |
T |
 |
| Q |
162 |
gagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||| |||||||||| |||| |
|
|
| T |
29628418 |
gagtttaaaatggctttgtcatt |
29628396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 120 - 184
Target Start/End: Complemental strand, 43133179 - 43133115
Alignment:
| Q |
120 |
catgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
43133179 |
catgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataatggctttgccatt |
43133115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 67 - 184
Target Start/End: Complemental strand, 12014858 - 12014744
Alignment:
| Q |
67 |
cagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtt |
166 |
Q |
| |
|
||||||| ||| |||| |||| ||||| ||||||||||||||| | | ||| |||||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
12014858 |
cagaagtcctaactcaactggtaaaataccgaaattgttaggccag---acgccttgaccggggttcgaaccccggtgcctccacttgtgtgtgtgagtt |
12014762 |
T |
 |
| Q |
167 |
tataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||| |||| |
|
|
| T |
12014761 |
tataatggctttgccatt |
12014744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 67 - 184
Target Start/End: Original strand, 38261003 - 38261117
Alignment:
| Q |
67 |
cagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtt |
166 |
Q |
| |
|
||||||| |||||||| ||| ||||||||||||||||||||||||| |||||||||||| ||||| |||| | ||||| ||||| |||||||||||| |
|
|
| T |
38261003 |
cagaagtcctagctcaactgacaaaatgtcgaaattgttaggccgg---atgccatgaccgaggttctaacctggataccttcacttatgtgtgtgagtt |
38261099 |
T |
 |
| Q |
167 |
tataatggctttggcatt |
184 |
Q |
| |
|
||||||| ||||| |||| |
|
|
| T |
38261100 |
tataatgactttgtcatt |
38261117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 64 - 173
Target Start/End: Complemental strand, 42557631 - 42557525
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
||||| |||| |||||||| |||||||||| ||||||||||||||||| ||||||||| ||||||| |||| | ||||||||||||| ||||||||| |
|
|
| T |
42557631 |
atccataagtcctagctcaattggcaaaatgccgaaattgttaggccgg---atgccatgatcggggtttgaactccggtacctccacttatgtgtgtga |
42557535 |
T |
 |
| Q |
164 |
gtttataatg |
173 |
Q |
| |
|
|||||||||| |
|
|
| T |
42557534 |
gtttataatg |
42557525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 63 - 184
Target Start/End: Original strand, 46274945 - 46275066
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaa-tgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgt-- |
159 |
Q |
| |
|
|||||| ||||||||||||| | || |||| || ||||||||||||| ||| ||||||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
46274945 |
tatccataagttctagctcaaccggtaaaaatgccgaaattgttaggtcgg---atgccatgaccggggttcgaatcccggtacctccacttgtgtgtgc |
46275041 |
T |
 |
| Q |
160 |
gtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||||||| |||| |
|
|
| T |
46275042 |
gtgagtttataatggctttgccatt |
46275066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 76 - 184
Target Start/End: Original strand, 990226 - 990331
Alignment:
| Q |
76 |
tagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggc |
175 |
Q |
| |
|
||||||| ||| || |||| | ||||||||||||||| |||| |||| |||||||||||||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
990226 |
tagctcaactgacataatggcaaaattgttaggccgg---atgctatgatcggggttcgaaccctggtacctccacttatgtttgtgagtttataatggc |
990322 |
T |
 |
| Q |
176 |
tttggcatt |
184 |
Q |
| |
|
|||| |||| |
|
|
| T |
990323 |
tttgccatt |
990331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 64 - 184
Target Start/End: Complemental strand, 2286222 - 2286105
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
||||| |||| |||||||| ||| ||||||| | ||||||||||||||| ||||||||||| | |||||||||| | ||||||||||| ||||||||| |
|
|
| T |
2286222 |
atccaaaagtcctagctcaactgacaaaatgccaaaattgttaggccgg---atgccatgaccagagttcgaaccccgctacctccacttatgtgtgtga |
2286126 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||| ||||| |||| |
|
|
| T |
2286125 |
gtttataatgactttgtcatt |
2286105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 43723311 - 43723428
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
||||| |||| ||||||| ||||||||||| | ||||||||| ||||| ||| ||||| ||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
43723311 |
atccacaagtcctagctcgactggcaaaatgccaaaattgttaagccgg---atgtcatgattggggttcgaaccccggttcctccacttgtgtgtgtga |
43723407 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
43723408 |
gtttataatggctttgccatt |
43723428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 89 - 184
Target Start/End: Original strand, 5523817 - 5523909
Alignment:
| Q |
89 |
aaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||||||||||||| |||| ||||||||||| || ||||||| |||||||||||||| |||| |
|
|
| T |
5523817 |
aaaatgtcgaaattgttaggtcgg---atgccatgaccggggttcgaatcctgatacctccacttatgcgtgtgagattataatggctttgtcatt |
5523909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 65 - 184
Target Start/End: Complemental strand, 6384646 - 6384531
Alignment:
| Q |
65 |
tccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgag |
164 |
Q |
| |
|
||||||||| |||||||| |||| ||||| ||||||||||||||||| | |||||||| ||||||||||||| ||| ||||||||| |||||||||| |
|
|
| T |
6384646 |
tccagaagtcctagctcaactggtaaaataccgaaattgttaggccgg---acgccatgac-ggggttcgaaccccggtgcctccacttatgtgtgtgag |
6384551 |
T |
 |
| Q |
165 |
tttataatggctttggcatt |
184 |
Q |
| |
|
||||||||| ||||| |||| |
|
|
| T |
6384550 |
tttataatgactttgccatt |
6384531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 64 - 172
Target Start/End: Complemental strand, 31300126 - 31300019
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccact--tgtgtgtgt |
161 |
Q |
| |
|
|||||||||| |||||| | ||||||||||| ||||||||||| ||||| ||| ||||||||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
31300126 |
atccagaagtcctagctaaactggcaaaatgccgaaattgttaagccgg---atgtcatgaccggggttcgaacctcggtacctccacttatgtgtgtgt |
31300030 |
T |
 |
| Q |
162 |
gagtttataat |
172 |
Q |
| |
|
||||||||||| |
|
|
| T |
31300029 |
gagtttataat |
31300019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 64 - 171
Target Start/End: Complemental strand, 32251464 - 32251360
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||| ||| ||||||||||| ||||||||||| | |||||| |||||||||||||||||||| | ||||||||||| ||||||||| |
|
|
| T |
32251464 |
atccagaagtcctagttcaactggcaaaatgccgaaattgtta---agtcggatgtcatgaccggggttcgaaccccgatacctccacttatgtgtgtga |
32251368 |
T |
 |
| Q |
164 |
gtttataa |
171 |
Q |
| |
|
|||||||| |
|
|
| T |
32251367 |
gtttataa |
32251360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 63 - 184
Target Start/End: Original strand, 34708671 - 34708788
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaa-tgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgt |
161 |
Q |
| |
|
|||| |||||| |||||||| ||||||||| || ||| |||||||||| || |||||||||||||||||||||||| |||||||||||| | ||||| |
|
|
| T |
34708671 |
tatctagaagtcctagctcaactggcaaaaatgccgatattgttaggctgg---atgccatgaccggggttcgaaccccggtacctccact--tatgtgt |
34708765 |
T |
 |
| Q |
162 |
gagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||||| |||| |
|
|
| T |
34708766 |
gagtttataatggctttgccatt |
34708788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 85 - 184
Target Start/End: Complemental strand, 35376968 - 35376872
Alignment:
| Q |
85 |
tggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||| |||| ||||||||||||||| ||||||||| ||| |||| |||||||||||||||| ||||||||| |||||||||||||||||| |||| |
|
|
| T |
35376968 |
tggcaaagtgtcaaaattgttaggccgg---atgccatgatcggagttcaaaccctggtacctccatttgtgtgtgagagtttataatggctttgccatt |
35376872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 62 - 184
Target Start/End: Original strand, 45946707 - 45946826
Alignment:
| Q |
62 |
atatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgt |
161 |
Q |
| |
|
||||||| |||| |||||||| ||| ||||||| | ||||| ||||||||| ||||||| || || ||||||||| ||||||||||||||||||||| |
|
|
| T |
45946707 |
atatccaaaagtcctagctcaactgacaaaatgccaaaattattaggccgg---atgccattactggagttcgaacctcggtacctccacttgtgtgtgt |
45946803 |
T |
 |
| Q |
162 |
gagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||| |||||||||| |||| |
|
|
| T |
45946804 |
gagtttacaatggctttgtcatt |
45946826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 64 - 178
Target Start/End: Original strand, 46416548 - 46416659
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||| ||| ||||||||||| ||| ||||||||||||| |||||||||||| ||||||| | | ||||||||||| ||||||||| |
|
|
| T |
46416548 |
atccagaagtcctaggtcaactggcaaaatgccgacattgttaggccgg---atgccatgaccgaaattcgaactccgatacctccacttatgtgtgtga |
46416644 |
T |
 |
| Q |
164 |
gtttataatggcttt |
178 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
46416645 |
gtttataatggcttt |
46416659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 84 - 184
Target Start/End: Complemental strand, 1582725 - 1582630
Alignment:
| Q |
84 |
ctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcat |
183 |
Q |
| |
|
||||||||||| ||||||||||||||||| |||| ||||||||||||||||||| |||||||| ||||||| |||||||||||||| |||||| ||| |
|
|
| T |
1582725 |
ctggcaaaatgccgaaattgttaggccgg---atgctatgaccggggttcgaaccccggtacctctacttgtg--tgtgagtttataatagctttgccat |
1582631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #74
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 75 - 184
Target Start/End: Complemental strand, 10704009 - 10703903
Alignment:
| Q |
75 |
ctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatgg |
174 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||||| | ||| ||| | |||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
10704009 |
ctagctcaactggcaaaatgccgaaattgttaggccgt---acgccttgatcaaggttcgaaccttggtacctccacttctgtgtgtgagtttataatgg |
10703913 |
T |
 |
| Q |
175 |
ctttggcatt |
184 |
Q |
| |
|
||||| |||| |
|
|
| T |
10703912 |
ctttgtcatt |
10703903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #75
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 63 - 160
Target Start/End: Complemental strand, 40857470 - 40857376
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtg |
160 |
Q |
| |
|
||||||||||| |||||||| ||| |||||||||||||||||||| ||| ||||||||| |||||||||||||| ||||||||||||| |||||| |
|
|
| T |
40857470 |
tatccagaagtcctagctcaaatggtaaaatgtcgaaattgttaggtcgg---atgccatgatcggggttcgaaccccggtacctccacttatgtgtg |
40857376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #76
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 93 - 184
Target Start/End: Original strand, 8856305 - 8856391
Alignment:
| Q |
93 |
tgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||||||| || |||||||||| ||||||||||||||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
8856305 |
tgtcgaaattgttaggccgg---ataccatgaccggagttcgaaccctggtacctctact--tgtgtgtgagtttataatggctttgccatt |
8856391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #77
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 47182802 - 47182919
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
||||| |||| |||||||| ||||||||||| | |||||||||| |||| ||||||||| | |||||||||||| |||| ||||| ||||||| |||| |
|
|
| T |
47182802 |
atccataagtcctagctcaactggcaaaatgccaaaattgttagaccgg---atgccatgatcagggttcgaaccccggtatctccatttgtgtgagtga |
47182898 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||| ||||||| |||| |
|
|
| T |
47182899 |
gtttataacggctttgccatt |
47182919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #78
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 62 - 184
Target Start/End: Original strand, 6596539 - 6596656
Alignment:
| Q |
62 |
atatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgt |
161 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||| | |||||||||||| |||||||||||||||||||||||| | |||||| |||| | ||||| |
|
|
| T |
6596539 |
atatccagaagtcctagctcaactggcaaaatgccaaaattgttaggc---cggatgccatgaccggggttcgaattccagtaccttcact--tatgtgt |
6596633 |
T |
 |
| Q |
162 |
gagtttataatggctttggcatt |
184 |
Q |
| |
|
|| ||||||||||||||| |||| |
|
|
| T |
6596634 |
gaatttataatggctttgccatt |
6596656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #79
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 89 - 179
Target Start/End: Complemental strand, 46021535 - 46021447
Alignment:
| Q |
89 |
aaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctcca-cttgtgtgtgtgagtttataatggctttg |
179 |
Q |
| |
|
|||||| ||||||||||||||||| ||| |||||||||||||||||||| |||||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
46021535 |
aaaatgccgaaattgttaggccgg---atgtcatgaccggggttcgaaccccggtacctccattttgtgtgtgtgagtttatgatggctttg |
46021447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #80
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 89 - 178
Target Start/End: Complemental strand, 9234351 - 9234265
Alignment:
| Q |
89 |
aaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggcttt |
178 |
Q |
| |
|
|||||| ||||||||||||||||| | || |||||||| ||||||| || |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
9234351 |
aaaatgccgaaattgttaggccgg---acgctatgaccggagttcgaatcccggtatctccacttgtgtgtgtgagtttataatggcttt |
9234265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #81
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 62 - 184
Target Start/End: Original strand, 26794909 - 26795030
Alignment:
| Q |
62 |
atatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccact--tgtgtgt |
159 |
Q |
| |
|
||||||| |||| |||||||| | ||||||||| | |||||||||| ||| |||||||||||||||||||||| | |||||||||||| | ||||| |
|
|
| T |
26794909 |
atatccacaagtcctagctcaaccggcaaaatgccaaaattgttagatcgg---atgccatgaccggggttcgaactccggtacctccacttatatgtgt |
26795005 |
T |
 |
| Q |
160 |
gtgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||| |||| |||| |
|
|
| T |
26795006 |
gtgagtttataatggttttgccatt |
26795030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #82
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 96 - 184
Target Start/End: Original strand, 36254158 - 36254242
Alignment:
| Q |
96 |
cgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||| |||||||||| ||||||||||| ||||||||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
36254158 |
cgaaattgttaggccg----atgccatgactagggttcgaaccacggtacctccacttgtgtgtgtgagtttataatgactttgccatt |
36254242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #83
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 70 - 178
Target Start/End: Original strand, 6369533 - 6369637
Alignment:
| Q |
70 |
aagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttat |
169 |
Q |
| |
|
|||||||| |||| |||| |||||| ||||||||||||||||| ||| ||||| || ||||| ||||| | ||||||||||| ||||||||||||||| |
|
|
| T |
6369533 |
aagttctaactcaactggtaaaatgccgaaattgttaggccgg---atgtcatgatcgtggttc-aaccccgatacctccacttatgtgtgtgagtttat |
6369628 |
T |
 |
| Q |
170 |
aatggcttt |
178 |
Q |
| |
|
||||||||| |
|
|
| T |
6369629 |
aatggcttt |
6369637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #84
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 70 - 178
Target Start/End: Original strand, 6377998 - 6378102
Alignment:
| Q |
70 |
aagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttat |
169 |
Q |
| |
|
|||||||| |||| |||| |||||| ||||||||||||||||| ||| ||||| || ||||| ||||| | ||||||||||| ||||||||||||||| |
|
|
| T |
6377998 |
aagttctaactcaactggtaaaatgccgaaattgttaggccgg---atgtcatgatcgtggttc-aaccccgatacctccacttatgtgtgtgagtttat |
6378093 |
T |
 |
| Q |
170 |
aatggcttt |
178 |
Q |
| |
|
||||||||| |
|
|
| T |
6378094 |
aatggcttt |
6378102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #85
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 64 - 184
Target Start/End: Complemental strand, 22752963 - 22752846
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
||||| |||| |||||||| || | ||||| |||||||||| ||||||| |||| |||| |||||||||||||| |||||||||||| ||||| ||| |
|
|
| T |
22752963 |
atccataagtcctagctcaactagaaaaatatcgaaattgtaaggccgg---atgctatgatcggggttcgaaccccagtacctccacttatgtgtatga |
22752867 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||| ||||| |||| |
|
|
| T |
22752866 |
gtttataatgactttgccatt |
22752846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #86
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 68 - 159
Target Start/End: Complemental strand, 43416413 - 43416324
Alignment:
| Q |
68 |
agaagttctagctcagctggcaaaa-tgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgt |
159 |
Q |
| |
|
|||||||||| |||| ||||||||| || ||| ||||||||||||| || ||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
43416413 |
agaagttctaactcaactggcaaaaatgccgatattgttaggccgg---ataccatgaccggggttcgaaccccggtacctccacttgtgtgt |
43416324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #87
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 70 - 184
Target Start/End: Complemental strand, 13769746 - 13769637
Alignment:
| Q |
70 |
aagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttat |
169 |
Q |
| |
|
|||| |||||||| |||||||||| |||||||||| |||||| | ||||||||||| ||||||||| |||||||||||||||| ||||| ||||| |
|
|
| T |
13769746 |
aagtcctagctcaattggcaaaatgccgaaattgttgggccgg---actccatgaccgggattcgaaccccggtacctccacttgtg--tgtgattttat |
13769652 |
T |
 |
| Q |
170 |
aatggctttggcatt |
184 |
Q |
| |
|
|||||||||| |||| |
|
|
| T |
13769651 |
aatggctttgtcatt |
13769637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #88
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 67 - 178
Target Start/End: Original strand, 24382593 - 24382701
Alignment:
| Q |
67 |
cagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtt |
166 |
Q |
| |
|
|||||||||||||||| |||| ||||| ||||||||||||| ||| |||| |||| ||||||||||| | | ||||||||||||||||| |||||| |
|
|
| T |
24382593 |
cagaagttctagctcaactggtaaaataccgaaattgttaggtcgg---atgctatgattggggttcgaactccgttacctccacttgtgtgtatgagtt |
24382689 |
T |
 |
| Q |
167 |
tataatggcttt |
178 |
Q |
| |
|
||||||| |||| |
|
|
| T |
24382690 |
tataatgacttt |
24382701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #89
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 89 - 184
Target Start/End: Original strand, 30627648 - 30627740
Alignment:
| Q |
89 |
aaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||||| |||||| ||||| || ||||||||||| |||||||||||||||||||||||||||| |||| ||||| |||| |
|
|
| T |
30627648 |
aaaatgtcgaaattgttag---atcggatgtcatgatcgaggttcgaaccccggtacctccacttgtgtgtgtgagtttacaatgactttgtcatt |
30627740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #90
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 119 - 184
Target Start/End: Original strand, 40677069 - 40677134
Alignment:
| Q |
119 |
ccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||||| || ||||||| ||||||||||||||||||||||| |||||| |||| |
|
|
| T |
40677069 |
ccatgaccggggttcgaactctcgtacctctacttgtgtgtgtgagtttataatagctttgtcatt |
40677134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #91
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 89 - 184
Target Start/End: Complemental strand, 46715794 - 46715702
Alignment:
| Q |
89 |
aaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||||||| | |||||||||||||||||||||||| ||||||||||||| |||||||||||||||| ||||| |||| |
|
|
| T |
46715794 |
aaaatgtcgaaattgttaggcaga---atgccatgaccggggttcgaaccccactacctccacttgtccgtgtgagtttataatgactttgtcatt |
46715702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #92
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 89 - 184
Target Start/End: Original strand, 33906305 - 33906399
Alignment:
| Q |
89 |
aaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccac--ttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||| | ||||||||||||||| | | |||||||||||||||||| | ||||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
33906305 |
aaaatgccaaaattgttaggccgg---acgtcatgaccggggttcgaacaccggtacctccacgcttgtgtgtgtgagtttataatggctttgtcatt |
33906399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #93
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 67 - 179
Target Start/End: Complemental strand, 19563221 - 19563114
Alignment:
| Q |
67 |
cagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtt |
166 |
Q |
| |
|
|||||||||||||||| || | |||||| ||||||||||||| ||| ||||||||| ||||||| |||| | |||| |||||||| |||||||||| |
|
|
| T |
19563221 |
cagaagttctagctcaactagtaaaatgccgaaattgttaggtcgg---atgccatgatcggggtttgaactccggtatctccacttatgtgtgtgag-- |
19563127 |
T |
 |
| Q |
167 |
tataatggctttg |
179 |
Q |
| |
|
||||||||||||| |
|
|
| T |
19563126 |
tataatggctttg |
19563114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #94
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 126 - 184
Target Start/End: Complemental strand, 788928 - 788870
Alignment:
| Q |
126 |
cggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||||||||||||||||| |||||| |||| |
|
|
| T |
788928 |
cggggttcgaaccccggtgcctccacttgtgtgtgtgagtttataatagctttgtcatt |
788870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #95
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 67 - 179
Target Start/End: Complemental strand, 3043942 - 3043833
Alignment:
| Q |
67 |
cagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtt |
166 |
Q |
| |
|
||||||| |||||||| || ||||||| |||||||||||||||| ||| ||||| || |||||||||| | ||||||||||| |||||||||||| |
|
|
| T |
3043942 |
cagaagtcctagctcaattgataaaatgttgaaattgttaggccgg---atgtcatgattggagttcgaaccccgatacctccacttatgtgtgtgagtt |
3043846 |
T |
 |
| Q |
167 |
tataatggctttg |
179 |
Q |
| |
|
||||||| ||||| |
|
|
| T |
3043845 |
tataatgactttg |
3043833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #96
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 58 - 178
Target Start/End: Complemental strand, 38930413 - 38930296
Alignment:
| Q |
58 |
atttatatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgt |
157 |
Q |
| |
|
||||| |||||||||| |||||||| ||||||| |||| |||||||||||| | ||| ||||| |||||| |||| ||||||||||||||||| |
|
|
| T |
38930413 |
atttaaatccagaagtcctagctcaattggcaaagtgtcaaaattgttaggctga---atgtcatgattggggtttgaacttcggtacctccacttgtgt |
38930317 |
T |
 |
| Q |
158 |
gtgtgagtttataatggcttt |
178 |
Q |
| |
|
|||| |||||||||||||||| |
|
|
| T |
38930316 |
gtgtaagtttataatggcttt |
38930296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #97
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 43188528 - 43188648
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaa-tgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccact--tgtgtgtg |
160 |
Q |
| |
|
|||||||||| |||||||| |||||||| || |||||||||||||||| |||||||||| |||||||||||| |||||||||| |||||||| |
|
|
| T |
43188528 |
atccagaagtactagctcaagtggcaaaaatgccgaaattgttaggccgc---atgccatgactagggttcgaaccccaatacctccacttgtgtgtgtg |
43188624 |
T |
 |
| Q |
161 |
tgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||| ||||| |||| |
|
|
| T |
43188625 |
tgagtttataatgactttgtcatt |
43188648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #98
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 84 - 179
Target Start/End: Original strand, 20182800 - 20182892
Alignment:
| Q |
84 |
ctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttg |
179 |
Q |
| |
|
||||||||||| ||||||||||| || |||||| ||||| ||||||||||| | |||||||||||| ||||||||||||||| |||| ||||| |
|
|
| T |
20182800 |
ctggcaaaatgccgaaattgtta---cgtcggatgttatgactggggttcgaactccggtacctccactagtgtgtgtgagtttacaatgactttg |
20182892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #99
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 75 - 178
Target Start/End: Complemental strand, 28649484 - 28649384
Alignment:
| Q |
75 |
ctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatgg |
174 |
Q |
| |
|
|||||||| |||| ||||| ||||||||||||| ||| ||| ||||| || ||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
28649484 |
ctagctcaactggtaaaatagcgaaattgttaggtcgg---atgtcatgatcgaagttcgaacctcggtacctccacttgtgtgtgtgagtttataatga |
28649388 |
T |
 |
| Q |
175 |
cttt |
178 |
Q |
| |
|
|||| |
|
|
| T |
28649387 |
cttt |
28649384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #100
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 75 - 184
Target Start/End: Original strand, 40873196 - 40873301
Alignment:
| Q |
75 |
ctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacct-ccacttgtgtgtgtgagtttataatg |
173 |
Q |
| |
|
|||||||| | || |||||| ||||||| |||||| || |||||||||||||||||||||||| ||||||| ||||| ||||||||||||||||||| |
|
|
| T |
40873196 |
ctagctcaaccggtaaaatgccgaaattattaggctgg---atgccatgaccggggttcgaaccccggtacctcccact--tgtgtgtgagtttataatg |
40873290 |
T |
 |
| Q |
174 |
gctttggcatt |
184 |
Q |
| |
|
||||| |||| |
|
|
| T |
40873291 |
cctttgtcatt |
40873301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #101
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 76 - 179
Target Start/End: Original strand, 47459427 - 47459527
Alignment:
| Q |
76 |
tagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggc |
175 |
Q |
| |
|
||||||| |||| ||||||||||||||||||||| |||||| |||||||| ||||| ||| | |||||| ||| || | |||| |||||||||||||| |
|
|
| T |
47459427 |
tagctcaactggtaaaatgtcgaaattgttaggc---cggatgtcatgaccgaggttcaaactcaggtacccccatttatttgtgcgagtttataatggc |
47459523 |
T |
 |
| Q |
176 |
tttg |
179 |
Q |
| |
|
|||| |
|
|
| T |
47459524 |
tttg |
47459527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #102
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 121 - 177
Target Start/End: Complemental strand, 5723678 - 5723622
Alignment:
| Q |
121 |
atgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctt |
177 |
Q |
| |
|
|||||||| |||||||| | | ||||||||||||||||||||||||||||||||||| |
|
|
| T |
5723678 |
atgaccggagttcgaactccgatacctccacttgtgtgtgtgagtttataatggctt |
5723622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #103
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 113 - 184
Target Start/End: Original strand, 7264450 - 7264521
Alignment:
| Q |
113 |
cggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||| ||||||| |||||||| | ||||||||||||| ||||||||||||||||||| ||||| |||| |
|
|
| T |
7264450 |
cggatgctatgaccgaggttcgaatctcggtacctccacttatgtgtgtgagtttataatgactttgccatt |
7264521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #104
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 67 - 160
Target Start/End: Complemental strand, 10084425 - 10084336
Alignment:
| Q |
67 |
cagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtg |
160 |
Q |
| |
|
|||| ||||||||||| || | |||||| ||||||||||| ||||| ||||||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
10084425 |
cagaggttctagctcaactagaaaaatgccgaaattgttaagccgg---atgccatgaccggggttcgaatcc-cgtacctccacttgtgtgtg |
10084336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #105
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 41862786 - 41862901
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||| | | |||||||||||||||||||||||| ||| ||| ||| |||||||||||||||| ||||||| |||| | ||||||| |
|
|
| T |
41862786 |
atccagaagtcctagtttaattggcaaaatgtcgaaattgttaggtcgg---atgtcataaccggggttcgaaccccggtaccttcact--tatgtgtga |
41862880 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||| |||||| |||| |
|
|
| T |
41862881 |
atttataatagctttgtcatt |
41862901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #106
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 113 - 184
Target Start/End: Original strand, 45594845 - 45594916
Alignment:
| Q |
113 |
cggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||| ||||| |||||||||||| | |||||| ||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
45594845 |
cggatgtcatgatcggggttcgaacatttgtaccttcacttgtgtgtgtgagtttataatgactttgtcatt |
45594916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #107
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 92 - 184
Target Start/End: Original strand, 16862415 - 16862504
Alignment:
| Q |
92 |
atgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||||||| | | ||||| | | |||||||||| || |||||||||||||||||||||||||| ||| ||||| |||| |
|
|
| T |
16862415 |
atgtcgaaattgttaggccgg---acgtcatgatcagagttcgaaccccggcacctccacttgtgtgtgtgagtttatgatgactttgtcatt |
16862504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #108
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 134 - 184
Target Start/End: Original strand, 28382644 - 28382694
Alignment:
| Q |
134 |
gaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||| ||||||||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
28382644 |
gaaccccggtacctccacttctgtgtgtgagtttataatggctttgccatt |
28382694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #109
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 63 - 184
Target Start/End: Complemental strand, 5222703 - 5222587
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| ||| |||| |||| |||||| ||||||||||| | || ||| ||||| |||||||||||||| ||||||||||| ||| |||| |
|
|
| T |
5222703 |
tatccagaagtcctaactcaactggtaaaatgccgaaattgttaagttgg---atgtcatgatcggggttcgaaccccagtacctccact--tgtatgtg |
5222609 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||| ||||| |||| |
|
|
| T |
5222608 |
agtttataatgactttgccatt |
5222587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #110
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 86 - 184
Target Start/End: Complemental strand, 28019987 - 28019892
Alignment:
| Q |
86 |
ggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||| |||||||||||||| || ||| ||||| ||||||||||| | ||||||||||||||| ||| |||||||||||||| |||| |||| |
|
|
| T |
28019987 |
ggcaaaatatcgaaattgttaggatgg---atgtcatgattggggttcgaactccggtacctccacttgtatgtatgagtttataatggttttgtcatt |
28019892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #111
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 76 - 170
Target Start/End: Original strand, 28234937 - 28235028
Alignment:
| Q |
76 |
tagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttata |
170 |
Q |
| |
|
||||||| |||||||||| ||| ||||||||||||| | | ||| ||||||||| |||||| |||||||||||||| |||||||||||||| |
|
|
| T |
28234937 |
tagctcaattggcaaaatgccgatattgttaggccgg---acgtcataaccggggtttgaaccccagtacctccacttgtatgtgtgagtttata |
28235028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #112
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 67 - 184
Target Start/End: Original strand, 32986105 - 32986223
Alignment:
| Q |
67 |
cagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagt- |
165 |
Q |
| |
|
|||||||||||||||| ||| ||||| |||||||||||||| |||||||| |||| |||||||||||| ||| |||| |||| ||||||||| | |
|
|
| T |
32986105 |
cagaagttctagctcaactgataaaatatcgaaattgttagg---gcggatgctatgattggggttcgaacctcggttcctctacttatgtgtgtgaatg |
32986201 |
T |
 |
| Q |
166 |
---ttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||| |||| |
|
|
| T |
32986202 |
agcttataatggctttgtcatt |
32986223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #113
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 120 - 175
Target Start/End: Complemental strand, 9506918 - 9506862
Alignment:
| Q |
120 |
catgaccggggttcgaaccctggtacctccac-ttgtgtgtgtgagtttataatggc |
175 |
Q |
| |
|
|||||||| ||||||||| | ||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
9506918 |
catgaccgaggttcgaactccggtacctccactttgtgtgtgtgagtttatgatggc |
9506862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #114
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 127 - 179
Target Start/End: Original strand, 35289905 - 35289956
Alignment:
| Q |
127 |
ggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttg |
179 |
Q |
| |
|
||||||||||| |||||||||||| || ||||||||||||||| ||||||||| |
|
|
| T |
35289905 |
ggggttcgaactctggtacctccattt-tgtgtgtgagtttatgatggctttg |
35289956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #115
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 120 - 184
Target Start/End: Original strand, 39303689 - 39303753
Alignment:
| Q |
120 |
catgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||| ||||||||||||| ||||||||||||| ||||| | | |||||||| |||||| |||| |
|
|
| T |
39303689 |
catgactggggttcgaaccccggtacctccacttatgtgtataaatttataatagctttgtcatt |
39303753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #116
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 84 - 184
Target Start/End: Complemental strand, 9932287 - 9932189
Alignment:
| Q |
84 |
ctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgag-tttataatggctttggca |
182 |
Q |
| |
|
|||| |||||| |||||||||||| | ||||||||||| ||| |||||||||||| ||| ||||||| | |||||||| ||||||||| ||||| || |
|
|
| T |
9932287 |
ctggtaaaatgccgaaattgttag---gttggatgccatgatcggagttcgaaccctgatacttccacttatatgtgtgagttttataatgactttgaca |
9932191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #117
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 129 - 184
Target Start/End: Original strand, 17752657 - 17752712
Alignment:
| Q |
129 |
ggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||| | ||||||||||||||||||||| | |||||||||| |||| |||| |
|
|
| T |
17752657 |
ggttcgaactccggtacctccacttgtgtgtgtaaatttataatggttttgtcatt |
17752712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #118
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 141 - 184
Target Start/End: Complemental strand, 27339783 - 27339740
Alignment:
| Q |
141 |
ggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
27339783 |
ggtatctccacttgtgtgtgtgagtttataatgactttgtcatt |
27339740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #119
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 89 - 178
Target Start/End: Complemental strand, 41708646 - 41708561
Alignment:
| Q |
89 |
aaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggcttt |
178 |
Q |
| |
|
|||||||| ||||||||||| ||| ||| |||| |||||||||||||| | ||||||||||| ||| ||||||||||| |||||||| |
|
|
| T |
41708646 |
aaaatgtcaaaattgttaggtcgg---atgttatgatcggggttcgaaccccgatacctccactt-tgtatgtgagtttatgatggcttt |
41708561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #120
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 60 - 106
Target Start/End: Complemental strand, 36280058 - 36280012
Alignment:
| Q |
60 |
ttatatccagaagttctagctcagctggcaaaatgtcgaaattgtta |
106 |
Q |
| |
|
||||||| |||||| |||||||| ||||||||||| ||||||||||| |
|
|
| T |
36280058 |
ttatatctagaagtcctagctcaactggcaaaatgccgaaattgtta |
36280012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #121
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 119 - 184
Target Start/End: Complemental strand, 11075019 - 11074954
Alignment:
| Q |
119 |
ccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||| ||| ||||||| | ||||||| ||||| ||| ||||||||||||||||||||| |||| |
|
|
| T |
11075019 |
ccatgatcggagttcgaaatccggtaccttcacttatgtatgtgagtttataatggctttgccatt |
11074954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #122
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 89 - 179
Target Start/End: Complemental strand, 12645402 - 12645314
Alignment:
| Q |
89 |
aaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccac-ttgtgtgtgtgagtttataatggctttg |
179 |
Q |
| |
|
|||||||||||||||||||||||| | | ||||||| ||||||||||| |||||||||| || |||||||| |||||| |||| |||| |
|
|
| T |
12645402 |
aaaatgtcgaaattgttaggccgg---acgtaatgaccgaggttcgaacccctgtacctccactttatgtgtgtgggtttatgatggttttg |
12645314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #123
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 86 - 184
Target Start/End: Original strand, 35196896 - 35196989
Alignment:
| Q |
86 |
ggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||| |||||| ||||||| || |||||||||| ||||||||| ||||||||||||| | ||||||||||||||||| ||||| |||| |
|
|
| T |
35196896 |
ggcaaaatgccgaaatcgttaggctgg---atgccatgactaaggttcgaactatggtacctccact--tatgtgtgagtttataatgactttgtcatt |
35196989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #124
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 143 - 179
Target Start/End: Complemental strand, 8522840 - 8522804
Alignment:
| Q |
143 |
tacctccacttgtgtgtgtgagtttataatggctttg |
179 |
Q |
| |
|
|||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
8522840 |
tacctctacttgtgtgtgtgagtttataatgactttg |
8522804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #125
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 64 - 179
Target Start/End: Original strand, 23138648 - 23138764
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg- |
162 |
Q |
| |
|
|||||||||| |||||| | |||| |||||| |||||||||||| ||| ||| ||||| |||||| ||||| |||| ||||||||| ||||||| |
|
|
| T |
23138648 |
atccagaagtcctagcttaactggtaaaatgctgaaattgttaggtcgg---atgttatgactggggtttgaacctcggtatctccacttgcgtgtgtgt |
23138744 |
T |
 |
| Q |
163 |
---agtttataatggctttg |
179 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
23138745 |
gagagtttataatggctttg |
23138764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #126
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 63 - 173
Target Start/End: Complemental strand, 24829194 - 24829088
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
|||||| |||||||| ||| | || |||||||||||||||||||| ||| |||| |||| |||||||||||| | ||| || ||||| |||||||| |
|
|
| T |
24829194 |
tatccacaagttctaaatcaacgggtaaaatgtcgaaattgttaggtcgg---atgc-atgatcggggttcgaactccagtatcttcacttatgtgtgtg |
24829099 |
T |
 |
| Q |
163 |
agtttataatg |
173 |
Q |
| |
|
|||||| |||| |
|
|
| T |
24829098 |
agtttacaatg |
24829088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 92; Significance: 1e-44; HSPs: 147)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 63 - 184
Target Start/End: Original strand, 42448209 - 42448327
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
42448209 |
tatccagaagtcctagctcaactggcaaaatgtcgaaattgttaggccgg---atgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtg |
42448305 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
42448306 |
agtttataatggctttgccatt |
42448327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 67 - 184
Target Start/End: Original strand, 29119608 - 29119722
Alignment:
| Q |
67 |
cagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtt |
166 |
Q |
| |
|
||||||| |||||||| ||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29119608 |
cagaagtcctagctcaactggcaaaatgccgaaattgttaggccgg---atgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtt |
29119704 |
T |
 |
| Q |
167 |
tataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||| |||| |
|
|
| T |
29119705 |
tataatggctttgccatt |
29119722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 63 - 184
Target Start/End: Complemental strand, 39151056 - 39150938
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| |||||||| |||| |||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
39151056 |
tatccagaagtcctagctcaactggtaaaatgtcgaaattgttaggccgg---atgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtg |
39150960 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
39150959 |
agtttataatggctttgacatt |
39150938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 64 - 184
Target Start/End: Complemental strand, 4617895 - 4617778
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| |||| |||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4617895 |
atccagaagtcctagctcaactggtaaaatgtcgaaattgttaggccgg---atgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtga |
4617799 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
4617798 |
gtttataatggctttgccatt |
4617778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 16496599 - 16496716
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||| ||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
16496599 |
atccagaagtcctagttcaactggcaaaatgtcgaaattgttaggccgg---atgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtga |
16496695 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
16496696 |
gtttataatggctttgccatt |
16496716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 36569278 - 36569395
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| ||||||||||| ||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
36569278 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccgg---atgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtga |
36569374 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
36569375 |
gtttataatggctttgccatt |
36569395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 63 - 179
Target Start/End: Original strand, 42068539 - 42068652
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| |||||||||||||||||||| |||||||||||||| || |||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
42068539 |
tatccagaagtcctagctcagctggcaaaatgccgaaattgttaggctgg---atgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtg |
42068635 |
T |
 |
| Q |
163 |
agtttataatggctttg |
179 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
42068636 |
agtttataatggctttg |
42068652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 84; E-Value: 7e-40
Query Start/End: Original strand, 63 - 184
Target Start/End: Original strand, 4164957 - 4165075
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| |||||||| ||||||||||| ||||||||||||||||| ||| |||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
4164957 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccgg---atgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtg |
4165053 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
4165054 |
agtttataatggctttgccatt |
4165075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 6672240 - 6672357
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| ||||||||||| ||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6672240 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccgg---atgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtga |
6672336 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||| |||| |||| |
|
|
| T |
6672337 |
gtttataatggttttgccatt |
6672357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 18473913 - 18474030
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| ||||||||||| ||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
18473913 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccgg---atgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtga |
18474009 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
| |||||||||||||| |||| |
|
|
| T |
18474010 |
ggttataatggctttgccatt |
18474030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 64 - 184
Target Start/End: Complemental strand, 23311302 - 23311185
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| ||||||||||| ||||||||||||||||| |||||||||||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
23311302 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccgg---atgccatgaccggggttcgaaccccggtacctccacttatgtgtgtga |
23311206 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
23311205 |
gtttataatggctttgccatt |
23311185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 64 - 184
Target Start/End: Complemental strand, 40045045 - 40044928
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||| ||| ||||||||||| ||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
40045045 |
atccagaagttctagctcagctggcaaaatgccgaaattgttaggtcgg---atgccatgaccagggttcgaatcctagtacctccacttgtgtgtgtga |
40044949 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
40044948 |
gtttataatggctttgccatt |
40044928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 64 - 179
Target Start/End: Complemental strand, 1244310 - 1244198
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| ||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
1244310 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccgg---atgccatgaccggggttcgaaccctggtacctccacttgagtgtgtgg |
1244214 |
T |
 |
| Q |
164 |
gtttataatggctttg |
179 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
1244213 |
gtttataatggctttg |
1244198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 61 - 184
Target Start/End: Complemental strand, 25328436 - 25328316
Alignment:
| Q |
61 |
tatatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtg |
160 |
Q |
| |
|
|||||| |||||| |||||||| ||||||||||| ||||||||||||||||| |||||||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
25328436 |
tatatctagaagtcctagctcaactggcaaaatgccgaaattgttaggccgg---atgccatgaccgaggttcgaaccccggtacctccacttgtgtgtg |
25328340 |
T |
 |
| Q |
161 |
tgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||||| |||| |
|
|
| T |
25328339 |
tgagtttataatggctttgccatt |
25328316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 62 - 184
Target Start/End: Complemental strand, 24652445 - 24652326
Alignment:
| Q |
62 |
atatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgt |
161 |
Q |
| |
|
|||||||||||| ||| |||| ||||||||||||||||||||||||||||| |||||||||||||| || |||||| ||||||||||||||||||||| |
|
|
| T |
24652445 |
atatccagaagtcctaactcaactggcaaaatgtcgaaattgttaggccgg---atgccatgaccgggatttgaaccccggtacctccacttgtgtgtgt |
24652349 |
T |
 |
| Q |
162 |
gagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||||| |||| |
|
|
| T |
24652348 |
gagtttataatggctttgccatt |
24652326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 64 - 184
Target Start/End: Complemental strand, 23074774 - 23074656
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaa-tgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
|||||||||| |||||||| ||||||||| || ||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
23074774 |
atccagaagtcctagctcaactggcaaaaatgccgaaattgttaggccgg---atgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtg |
23074678 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
23074677 |
agtttataatggctttgccatt |
23074656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 79; E-Value: 7e-37
Query Start/End: Original strand, 64 - 184
Target Start/End: Complemental strand, 9054100 - 9053983
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| |||||||||| ||||||||||||||||| |||||||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
9054100 |
atccagaagtcctagctcaactggcaaaataccgaaattgttaggccgg---atgccatgaccggggttcgaaccccgatacctccacttgtgtgtgtga |
9054004 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
9054003 |
gtttataatggctttgtcatt |
9053983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 79; E-Value: 7e-37
Query Start/End: Original strand, 64 - 184
Target Start/End: Complemental strand, 17869253 - 17869136
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| ||||||||||| ||||||||||||||||| |||||||||||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
17869253 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccgg---atgccatgaccggggttcgaaccccggtacctccacttatgtgtgtga |
17869157 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||| |||| |
|
|
| T |
17869156 |
atttataatggctttgccatt |
17869136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 79; E-Value: 7e-37
Query Start/End: Original strand, 76 - 184
Target Start/End: Original strand, 34930236 - 34930341
Alignment:
| Q |
76 |
tagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggc |
175 |
Q |
| |
|
||||||| ||||||||||| ||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
34930236 |
tagctcaactggcaaaatgccgaaattgttaggccgg---atgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataatggc |
34930332 |
T |
 |
| Q |
176 |
tttggcatt |
184 |
Q |
| |
|
|||| |||| |
|
|
| T |
34930333 |
tttgccatt |
34930341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 79; E-Value: 7e-37
Query Start/End: Original strand, 68 - 184
Target Start/End: Original strand, 37940921 - 37941034
Alignment:
| Q |
68 |
agaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagttt |
167 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||||||||||||||| ||||||||| |||||||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
37940921 |
agaagtcctagctcaactggcaaaatgtcgaaattgttaggccgg---atgccatgatcggggttcgaaccccgatacctccacttgtgtgtgtgagttt |
37941017 |
T |
 |
| Q |
168 |
ataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||| |||| |
|
|
| T |
37941018 |
ataatggctttgccatt |
37941034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 79; E-Value: 7e-37
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 41562457 - 41562574
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| ||||||||||| ||||||||||||||||| ||||||||||||| |||||||| | ||||||||||||||||||||||| |
|
|
| T |
41562457 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccgg---atgccatgaccggagttcgaactccggtacctccacttgtgtgtgtga |
41562553 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
41562554 |
gtttataatggctttgccatt |
41562574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 63 - 174
Target Start/End: Complemental strand, 28143362 - 28143254
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| |||||||| ||||||||||| ||||||||||||||||| |||||||||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
28143362 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccgg---atgccatgactggggttcgaaccccggtacctccacttgtgtgtgtg |
28143266 |
T |
 |
| Q |
163 |
agtttataatgg |
174 |
Q |
| |
|
|||||||||||| |
|
|
| T |
28143265 |
agtttataatgg |
28143254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 63 - 184
Target Start/End: Original strand, 11968774 - 11968892
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| ||| |||| ||| ||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||| || |
|
|
| T |
11968774 |
tatccagaagtcctaactcaactgtcaaaatgtcgaaattgttaggccgg---atgccatgaccggggttcgaaccccagtacctccacttgtgtgtatg |
11968870 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
11968871 |
agtttataatggctttgccatt |
11968892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 1650290 - 1650407
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| | |||||||| ||||||||||||||||| |||||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
1650290 |
atccagaagtcctagctcaacctgcaaaatgccgaaattgttaggccgg---atgccatgaccggggttcgaactccggtacctccacttgtgtgtgtga |
1650386 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
1650387 |
gtttataatggctttgccatt |
1650407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 6029611 - 6029728
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||| ||||||||||||||| ||| |||| | ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6029611 |
atccagaagtcctagctcaactggcaaaatgtcaaaattgttaggccgg---atgtcatgcctggggttcgaaccccggtacctccacttgtgtgtgtga |
6029707 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
6029708 |
gtttataatggctttgccatt |
6029728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 84 - 184
Target Start/End: Complemental strand, 36854267 - 36854170
Alignment:
| Q |
84 |
ctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcat |
183 |
Q |
| |
|
||||||||||| ||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
36854267 |
ctggcaaaatgccgaaattgttaggccgg---atgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataatggctttgccat |
36854171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 63 - 178
Target Start/End: Original strand, 2103024 - 2103136
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| |||||||| ||||||||||| ||||||||||||||||| ||||||||| |||| ||||||||| ||||||| |||||||||||||| |
|
|
| T |
2103024 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccgg---atgccatgatcgggattcgaaccccggtacctacacttgtgtgtgtg |
2103120 |
T |
 |
| Q |
163 |
agtttataatggcttt |
178 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
2103121 |
agtttataatggcttt |
2103136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 67 - 184
Target Start/End: Complemental strand, 10393628 - 10393514
Alignment:
| Q |
67 |
cagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtt |
166 |
Q |
| |
|
||||||| |||||||| |||| |||||| ||||||| ||||||||| ||||| |||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
10393628 |
cagaagtcctagctcaactggaaaaatgccgaaattattaggccgg---atgccttgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtt |
10393532 |
T |
 |
| Q |
167 |
tataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||| |||| |
|
|
| T |
10393531 |
tataatggctttgtcatt |
10393514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 1287314 - 1287431
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| ||| |||||| ||||||||||||| ||| ||| |||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1287314 |
atccagaagtcctagctcaattggtaaaatgccgaaattgttaggtcgg---atgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtga |
1287410 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
1287411 |
gtttataatggctttgccatt |
1287431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 70 - 184
Target Start/End: Original strand, 40595962 - 40596072
Alignment:
| Q |
70 |
aagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttat |
169 |
Q |
| |
|
|||| |||||||| ||||||||||| |||||||||||||||| |||||||||| ||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
40595962 |
aagtcctagctcaactggcaaaatgccgaaattgttaggccg----atgccatgactggggttcgaaccccggtacctccacttgtgtgtgtgagtttat |
40596057 |
T |
 |
| Q |
170 |
aatggctttggcatt |
184 |
Q |
| |
|
|||| ||||| |||| |
|
|
| T |
40596058 |
aatgactttgtcatt |
40596072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 67 - 184
Target Start/End: Complemental strand, 9902627 - 9902512
Alignment:
| Q |
67 |
cagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgag-t |
165 |
Q |
| |
|
||||||| |||||||| ||||||||||| ||||||||||||||||| |||| |||| |||||||||||||| |||||||||||||||||||||||| | |
|
|
| T |
9902627 |
cagaagtcctagctcaactggcaaaatgccgaaattgttaggccgg---atgctatgatcggggttcgaaccccggtacctccacttgtgtgtgtgagtt |
9902531 |
T |
 |
| Q |
166 |
ttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||| |||| |
|
|
| T |
9902530 |
ttataatggctttgccatt |
9902512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 63 - 184
Target Start/End: Original strand, 36726987 - 36727103
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| |||||||| ||||||||||| |||||||||||||| ||||||||||||||||||| |||||| ||||||||||||||| |||||| |
|
|
| T |
36726987 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggc---cggatgccatgaccggggt--gaaccccggtacctccacttgtctgtgtg |
36727081 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||| ||||| |||| |
|
|
| T |
36727082 |
agtttataatgactttgccatt |
36727103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 66 - 184
Target Start/End: Original strand, 38682929 - 38683044
Alignment:
| Q |
66 |
ccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagt |
165 |
Q |
| |
|
|||||||| |||||||| ||||||||||| | |||||||||||| || |||||||||||||||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
38682929 |
ccagaagtcctagctcaactggcaaaatgccaaaattgttaggctgg---atgccatgaccggggttcgaaccccggtaccctcacttgtgtgtgtgagt |
38683025 |
T |
 |
| Q |
166 |
ttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||| |||| |
|
|
| T |
38683026 |
ttataatggctttgccatt |
38683044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 64 - 184
Target Start/End: Complemental strand, 1833449 - 1833331
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaa-tgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
|||||||||| ||||||| ||||||||| || ||||||||||||||||| || ||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
1833449 |
atccagaagtcatagctcaactggcaaaaatgccgaaattgttaggccgg---ataccatgaccggggttcgaaccccgatacctccacttgtgtgtgtg |
1833353 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
1833352 |
agtttataatggctttgccatt |
1833331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 63 - 184
Target Start/End: Original strand, 12665093 - 12665211
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| |||| ||| ||| ||||||| ||||||| ||||||||| |||||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
12665093 |
tatccagaagtcctagttcaactgacaaaatgccgaaattattaggccgg---atgccatgaccggggttcgaactccggtacctccacttgtgtgtgtg |
12665189 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
| ||||||||||||||| |||| |
|
|
| T |
12665190 |
aatttataatggctttgccatt |
12665211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 79 - 184
Target Start/End: Complemental strand, 27390041 - 27389939
Alignment:
| Q |
79 |
ctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggcttt |
178 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||||| ||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
27390041 |
ctcaactggcaaaatgccgaaattgttaggccgg---atgccatgaccggggttcgaacctcggtacctccacttatgtgtgtgagtttataatggcttt |
27389945 |
T |
 |
| Q |
179 |
ggcatt |
184 |
Q |
| |
|
| |||| |
|
|
| T |
27389944 |
gccatt |
27389939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 63 - 184
Target Start/End: Original strand, 29806565 - 29806683
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||| | |||||||| |||| |||||| | ||||||||||||||| |||||||||| ||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
29806565 |
tatccagaaatcctagctcaactggtaaaatgccaaaattgttaggccgg---atgccatgactggggttcgaaccccggtaccttcacttgtgtgtgtg |
29806661 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
29806662 |
agtttataatggctttgccatt |
29806683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 64 - 184
Target Start/End: Complemental strand, 40318915 - 40318797
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaa-tgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
|||||||||| ||||||| ||||||||| || ||||||||||||||||| || ||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
40318915 |
atccagaagtcatagctcaactggcaaaaatgccgaaattgttaggccgg---ataccatgaccggggttcgaaccccgatacctccacttgtgtgtgtg |
40318819 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
40318818 |
agtttataatggctttgccatt |
40318797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 64 - 184
Target Start/End: Complemental strand, 6041973 - 6041856
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| |||| |||||||||||||| ||||||||| |||| ||||||||| ||||||||| ||||||| ||||||||||||||| |
|
|
| T |
6041973 |
atccagaagtcctagctcaactggtaaaatgtcgaaattattaggccgg---atgctatgaccgggattcgaaccccggtaccttcacttgtgtgtgtga |
6041877 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
||||||| |||||||| |||| |
|
|
| T |
6041876 |
gtttatattggctttgccatt |
6041856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 64 - 172
Target Start/End: Complemental strand, 7179430 - 7179325
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||| | ||||||||||||||| ||| || ||| |||||||||||| ||||||||| |
|
|
| T |
7179430 |
atccagaagttctagctcaactggcaaaatgtcgaaattgttaggc---cagatgccatgaccgggattcaaatccttgtacctccacttatgtgtgtga |
7179334 |
T |
 |
| Q |
164 |
gtttataat |
172 |
Q |
| |
|
||||||||| |
|
|
| T |
7179333 |
gtttataat |
7179325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 24051402 - 24051519
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| ||| |||| ||||||||||| ||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
24051402 |
atccagaagtcctaactcaactggcaaaatgctaaaattattaggccgg---atgccatgaccggggttcgaaccctggtacctccacttgtgtatgtga |
24051498 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||| ||||| |||| |
|
|
| T |
24051499 |
gtttataatgactttgtcatt |
24051519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 64 - 184
Target Start/End: Complemental strand, 24443996 - 24443879
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| |||||||||| ||||||||||||| ||| ||| ||||||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
24443996 |
atccagaagtcctagctcaactggcaaaataccgaaattgttaggtcgg---atgttatgaccggggttcaaaccccggtacctccacttgtgtgtgtga |
24443900 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
24443899 |
gtttataatggctttgccatt |
24443879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 26802333 - 26802450
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| || |||| ||||||||||| | |||||||||||||| ||| |||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
26802333 |
atccagaagtcttaactcaactggcaaaatgccaaaattgttaggccga---atgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtga |
26802429 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
26802430 |
gtttataatggctttgccatt |
26802450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 26809883 - 26810000
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| || |||| ||||||||||| | |||||||||||||| ||| |||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
26809883 |
atccagaagtcttaactcaactggcaaaatgccaaaattgttaggccga---atgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtga |
26809979 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
26809980 |
gtttataatggctttgccatt |
26810000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 26824910 - 26825027
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| || |||| ||||||||||| | |||||||||||||| ||| |||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
26824910 |
atccagaagtcttaactcaactggcaaaatgccaaaattgttaggccga---atgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtga |
26825006 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
26825007 |
gtttataatggctttgccatt |
26825027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 77 - 184
Target Start/End: Original strand, 34856592 - 34856697
Alignment:
| Q |
77 |
agctcagctggcaaaa-tgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggc |
175 |
Q |
| |
|
|||||| ||||||||| || ||||||||||||||||| |||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
34856592 |
agctcaactggcaaaaatgccgaaattgttaggccgg---atgccatgaccggggttcgaaccccggtacctccacttatgtgtgtgagtttataatggc |
34856688 |
T |
 |
| Q |
176 |
tttggcatt |
184 |
Q |
| |
|
|||| |||| |
|
|
| T |
34856689 |
tttgccatt |
34856697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 64 - 172
Target Start/End: Complemental strand, 36136991 - 36136886
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| || |||||||| |||||||||||||||| |||| ||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
36136991 |
atccagaagtcctagctcaactagcaaaatgccgaaattgttaggccga---atgctatgaccggggttcgaaccccggtacctccacttgtgtgtgtga |
36136895 |
T |
 |
| Q |
164 |
gtttataat |
172 |
Q |
| |
|
||||||||| |
|
|
| T |
36136894 |
gtttataat |
36136886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 64 - 184
Target Start/End: Complemental strand, 36319631 - 36319514
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
||||| |||| |||||||| |||||||||| |||||||||||||||| |||||||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
36319631 |
atccaaaagtcctagctcaactggcaaaatactgaaattgttaggccgg---atgccatgacaggggttcgaaccccggtacctccacttgtgtgtgtga |
36319535 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||| |||| |
|
|
| T |
36319534 |
atttataatggctttgtcatt |
36319514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 63 - 184
Target Start/End: Original strand, 21728658 - 21728778
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaa-tgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgt |
161 |
Q |
| |
|
||||||||||| |||||||| ||||||||| || ||||||||||||||||| |||||||||||||||||||||||| ||| ||||||||| ||||||| |
|
|
| T |
21728658 |
tatccagaagtcctagctcaactggcaaaaatgccgaaattgttaggccgg---atgccatgaccggggttcgaaccccggtgcctccacttatgtgtgt |
21728754 |
T |
 |
| Q |
162 |
gag-tttataatggctttggcatt |
184 |
Q |
| |
|
||| ||||||||||||||| |||| |
|
|
| T |
21728755 |
gagttttataatggctttgccatt |
21728778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 62 - 184
Target Start/End: Complemental strand, 36790447 - 36790327
Alignment:
| Q |
62 |
atatccagaagttctagctcagctggcaaaa-tgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtg |
160 |
Q |
| |
|
||||| |||||| |||||| | ||||||||| || ||||||| ||||||||| |||| ||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
36790447 |
atatctagaagtcctagcttaactggcaaaaatgccgaaattattaggccgg---atgctatgaccggggttcgaaccccggtacctccacttgtgtgtg |
36790351 |
T |
 |
| Q |
161 |
tgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||||| |||| |
|
|
| T |
36790350 |
tgagtttataatggctttgccatt |
36790327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 62 - 184
Target Start/End: Complemental strand, 1269650 - 1269531
Alignment:
| Q |
62 |
atatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgt |
161 |
Q |
| |
|
|||||||||||| |||||||| ||| ||||||||||||||||||||||||| ||||||||| ||||||||||||| ||||||||||||| | ||||| |
|
|
| T |
1269650 |
atatccagaagtcctagctcaactgacaaaatgtcgaaattgttaggccgg---atgccatgattggggttcgaaccccggtacctccacttatttgtgt |
1269554 |
T |
 |
| Q |
162 |
gagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||| || |||||| |||| |
|
|
| T |
1269553 |
gagtttatgatagctttgtcatt |
1269531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 63 - 184
Target Start/End: Original strand, 9068801 - 9068919
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
|||||| |||| |||||||| |||| |||||||||||||||||||| ||| ||||||||| |||||||||||||| |||||||||| | ||||||||| |
|
|
| T |
9068801 |
tatccataagtcctagctcaactggtaaaatgtcgaaattgttaggtcgg---atgccatgatcggggttcgaaccccggtacctccattagtgtgtgtg |
9068897 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||| ||||| |||| |
|
|
| T |
9068898 |
agtttataatgactttgtcatt |
9068919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 34675746 - 34675863
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| | ||||||||| |||||||||||| | ||||||||||| |||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
34675746 |
atccagaagtcctagctcaacaggcaaaatgccgaaattgttag---gttggatgccatgatcgggattcgaaccccggtacctccacttgtgtgtgtga |
34675842 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||| |||||| |||| |
|
|
| T |
34675843 |
gtttataatagctttgccatt |
34675863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 64 - 179
Target Start/End: Original strand, 10165531 - 10165643
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
||||| |||| ||| |||| |||||||||| |||||||||||| |||| ||||||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
10165531 |
atccataagtcctaactcaattggcaaaatgccgaaattgttagaccgg---atgccatgatcggggttcgaaccccggtacctccacttgtgtgtgtga |
10165627 |
T |
 |
| Q |
164 |
gtttataatggctttg |
179 |
Q |
| |
|
|||||||||| ||||| |
|
|
| T |
10165628 |
gtttataatgactttg |
10165643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 89 - 184
Target Start/End: Original strand, 36259821 - 36259913
Alignment:
| Q |
89 |
aaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||||||||||||||| || ||||||||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
36259821 |
aaaatgtcgaaattgttaggccgg---atgtcatgaccggggttcgaatcccggtacctccacttatgtgtgtgagtttataatggctttgccatt |
36259913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 62 - 184
Target Start/End: Complemental strand, 18625746 - 18625627
Alignment:
| Q |
62 |
atatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgt |
161 |
Q |
| |
|
|||||||||||| ||| |||| ||||||||||| | |||||||||| || | ||||||||| |||||||||||||| |||||||||||||| ||||| |
|
|
| T |
18625746 |
atatccagaagtcctaactcaactggcaaaatgccaaaattgttagtccag---atgccatgatcggggttcgaaccccagtacctccacttgtatgtgt |
18625650 |
T |
 |
| Q |
162 |
gagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||||| |||| |
|
|
| T |
18625649 |
gagtttataatggctttgccatt |
18625627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 67 - 184
Target Start/End: Original strand, 39527934 - 39528046
Alignment:
| Q |
67 |
cagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtt |
166 |
Q |
| |
|
||||||| |||| ||| |||| |||||| |||||||||||||| || |||||||||||||||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
39527934 |
cagaagtcctagttcaactggtaaaatgccgaaattgttaggctgg---atgccatgaccggggttcgaaccccggtacctccact--tgtgtgtgagtt |
39528028 |
T |
 |
| Q |
167 |
tataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||| |||| |
|
|
| T |
39528029 |
tataatggctttgccatt |
39528046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 68 - 178
Target Start/End: Complemental strand, 43150283 - 43150176
Alignment:
| Q |
68 |
agaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagttt |
167 |
Q |
| |
|
|||||| ||| |||| ||||||||||| ||||||||||||||||| |||| |||| ||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
43150283 |
agaagtcctaactcaactggcaaaatggcgaaattgttaggccgg---atgctatgattggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
43150187 |
T |
 |
| Q |
168 |
ataatggcttt |
178 |
Q |
| |
|
|||||| |||| |
|
|
| T |
43150186 |
ataatgacttt |
43150176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 63 - 184
Target Start/End: Complemental strand, 671189 - 671071
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| |||| ||| ||||||||||| ||||||||||||| ||| ||| ||||| |||||||||||||| | ||||||||| |||||||||| |
|
|
| T |
671189 |
tatccagaagtcctagttcaactggcaaaatgccgaaattgttaggtcgg---atgtcatgatcggggttcgaaccccgatacctccacgtgtgtgtgtg |
671093 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||| ||||| |||| |
|
|
| T |
671092 |
agtttataatgactttgccatt |
671071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 1277436 - 1277554
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaa-tgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||| |||| |||||||||||| ||||| || ||||||||||||||||| |||||||||| ||| |||||||| |||||||||||||||||||||| |
|
|
| T |
1277436 |
atccacaagtcctagctcagctgccaaaaatgccgaaattgttaggccgg---atgccatgacagggattcgaacctcggtacctccacttgtgtgtgtg |
1277532 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||| ||||| |||| |
|
|
| T |
1277533 |
agtttataatgactttgtcatt |
1277554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 76 - 184
Target Start/End: Original strand, 16906348 - 16906458
Alignment:
| Q |
76 |
tagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccac-----ttgtgtgtgtgagtttata |
170 |
Q |
| |
|
||||||| ||||||||||| ||||||||||||||||| ||||||||| |||||||||||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
16906348 |
tagctcaactggcaaaatgccgaaattgttaggccgg---atgccatgatcggggttcgaaccccggtacctccacttgtgttgtgtgtgtgagtttata |
16906444 |
T |
 |
| Q |
171 |
atggctttggcatt |
184 |
Q |
| |
|
||||||||| |||| |
|
|
| T |
16906445 |
atggctttgccatt |
16906458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 113 - 184
Target Start/End: Complemental strand, 36246077 - 36246006
Alignment:
| Q |
113 |
cggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
36246077 |
cggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataatgactttgacatt |
36246006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 75 - 184
Target Start/End: Original strand, 37191254 - 37191360
Alignment:
| Q |
75 |
ctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatgg |
174 |
Q |
| |
|
|||||||| ||||||||||| | |||||||||||| || ||||||||| |||| ||||||||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
37191254 |
ctagctcaactggcaaaatgccaaaattgttaggctgg---atgccatgatcgggattcgaaccccggtacctccacttatgtgtgtgagtttataatgg |
37191350 |
T |
 |
| Q |
175 |
ctttggcatt |
184 |
Q |
| |
|
||||| |||| |
|
|
| T |
37191351 |
ctttgccatt |
37191360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 68 - 172
Target Start/End: Complemental strand, 4430066 - 4429965
Alignment:
| Q |
68 |
agaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagttt |
167 |
Q |
| |
|
|||| |||||||||| |||| |||||||||||||||||||||||| ||| |||||||||||||| ||||| | ||||||||||| ||||||||||||| |
|
|
| T |
4430066 |
agaaattctagctcaactggtaaaatgtcgaaattgttaggccgg---atgtcatgaccggggttcaaaccccgatacctccacttatgtgtgtgagttt |
4429970 |
T |
 |
| Q |
168 |
ataat |
172 |
Q |
| |
|
||||| |
|
|
| T |
4429969 |
ataat |
4429965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 70 - 178
Target Start/End: Complemental strand, 16371595 - 16371490
Alignment:
| Q |
70 |
aagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttat |
169 |
Q |
| |
|
|||| |||| ||| ||||||||||| | |||||||||||| || ||| ||||| |||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
16371595 |
aagtcctagttcaactggcaaaatgccaaaattgttaggctgg---atgtcatgatcggggttcgaaccccggtacctccacttgtgtgtgtgagtttat |
16371499 |
T |
 |
| Q |
170 |
aatggcttt |
178 |
Q |
| |
|
||||||||| |
|
|
| T |
16371498 |
aatggcttt |
16371490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 18115092 - 18115209
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
||||| |||||||| |||| || |||||||||| ||||||||||||||| || || |||||||| |||||| || ||||||||||||| ||||||||| |
|
|
| T |
18115092 |
atccaaaagttctaactcaactagcaaaatgtcaaaattgttaggccgg---ataccgtgaccgggattcgaaacccggtacctccacttatgtgtgtga |
18115188 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
18115189 |
gtttataatggctttgccatt |
18115209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 33617095 - 33617212
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| |||| |||||| ||| ||||||||||||| |||| |||| ||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
33617095 |
atccagaagtcctagctcaactggtaaaatgccgacattgttaggccgg---atgctatgattggggttcgaaccccggtatctccacttgtgtgtgtga |
33617191 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||| ||||||||| |||| |
|
|
| T |
33617192 |
gtttattatggctttgccatt |
33617212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #68
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 64 - 184
Target Start/End: Complemental strand, 26267130 - 26267011
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtg--tgt |
161 |
Q |
| |
|
|||||||||| ||||||| ||||||||||| ||||||||||| ||||| ||||||||| ||| ||||||||| |||||||||||||||||| ||| |
|
|
| T |
26267130 |
atccagaagtcgtagctcaactggcaaaatgccgaaattgttaagccgg---atgccatgatcggatttcgaaccccggtacctccacttgtgtgtgtgt |
26267034 |
T |
 |
| Q |
162 |
gagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||||| |||| |
|
|
| T |
26267033 |
gagtttataatggctttgccatt |
26267011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #69
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 63 - 178
Target Start/End: Original strand, 33028228 - 33028340
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
|||| |||||| |||| ||| ||| ||||||| | ||||||||||||||| ||| |||||||||||||||||||| ||||| ||||||| |||||||| |
|
|
| T |
33028228 |
tatcaagaagtcctagttcaactgacaaaatgccaaaattgttaggccgg---atgtcatgaccggggttcgaaccccggtacttccacttatgtgtgtg |
33028324 |
T |
 |
| Q |
163 |
agtttataatggcttt |
178 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
33028325 |
agtttataatggcttt |
33028340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #70
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 63 - 179
Target Start/End: Original strand, 39143439 - 39143555
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
|||||| |||| |||||||| |||||||||||||||||||||||||||| |||||||||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
39143439 |
tatccacaagtcctagctcaactggcaaaatgtcgaaattgttaggccga---atgccatgaccgaggttcgaaccc-ggtacctccacttgtgtgtgtg |
39143534 |
T |
 |
| Q |
163 |
----agtttataatggctttg |
179 |
Q |
| |
|
||||||||||| ||||| |
|
|
| T |
39143535 |
tgcgagtttataatgactttg |
39143555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #71
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 64 - 178
Target Start/End: Original strand, 41408625 - 41408737
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaa-tgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
|||||||||| ||||||| ||||||||| || ||||||||||||||||| || |||| |||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
41408625 |
atccagaagtcatagctcaactggcaaaaatgccgaaattgttaggccgg---ataccataaccggggttcgaaccccgatacctccacttgtgtgtgtg |
41408721 |
T |
 |
| Q |
163 |
agtttataatggcttt |
178 |
Q |
| |
|
||||||||| |||||| |
|
|
| T |
41408722 |
agtttataacggcttt |
41408737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #72
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 89 - 184
Target Start/End: Original strand, 5203575 - 5203669
Alignment:
| Q |
89 |
aaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccact--tgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| | |||||||||| ||||||||||||||||||||| ||||| |||| |
|
|
| T |
5203575 |
aaaatgtcgaaattgttaggccgg---atgccatgaccggggttcgaaccccgatacctccacttgtgtgtgtgtgagtttataatgactttgtcatt |
5203669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #73
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 64 - 174
Target Start/End: Complemental strand, 12708005 - 12707898
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| ||||||||||| ||||||||||||| ||| ||||||| ||| | |||||||||| ||||||||||||||||||||| |
|
|
| T |
12708005 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggtcgg---atgccatcaccagagttcgaaccccaatacctccacttgtgtgtgtga |
12707909 |
T |
 |
| Q |
164 |
gtttataatgg |
174 |
Q |
| |
|
||||||||||| |
|
|
| T |
12707908 |
gtttataatgg |
12707898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #74
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 63 - 184
Target Start/End: Complemental strand, 12878248 - 12878132
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| |||||||| ||||||||||| |||||||||||||| |||||| ||||| || |||||||||| | |||||||||| |||||||| |
|
|
| T |
12878248 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggc---cggatgtcatgatcgaagttcgaaccccgatacctccact--tgtgtgtg |
12878154 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
12878153 |
agtttataatggctttgccatt |
12878132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #75
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 63 - 184
Target Start/End: Original strand, 36185135 - 36185253
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||| | |||||||| ||||||||||||||||||||||||| | | || ||||| |||||||||||||| |||||||||||||||||| ||| |
|
|
| T |
36185135 |
tatccagaaatcctagctcaactggcaaaatgtcgaaattgttaggtcag---atatcatgatcggggttcgaaccccggtacctccacttgtgtgcgtg |
36185231 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
| |||||||| |||||| |||| |
|
|
| T |
36185232 |
aatttataatagctttgccatt |
36185253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #76
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 113 - 184
Target Start/End: Complemental strand, 38975821 - 38975750
Alignment:
| Q |
113 |
cggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||| ||||||||||||||| | ||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
38975821 |
cggatgccacgaccggggttcgaactccggtacctccacttgtgtgtgtgagtttataatggctttgtcatt |
38975750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #77
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 75 - 184
Target Start/End: Original strand, 41071072 - 41071178
Alignment:
| Q |
75 |
ctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatgg |
174 |
Q |
| |
|
|||||||| ||| |||||| ||||||||||||||||| |||||||| ||| |||||||||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
41071072 |
ctagctcaattggtaaaatgccgaaattgttaggccggg---tgccatgatcggagttcgaaccccgatacctccacttgtgtgtgtgagtttataatgg |
41071168 |
T |
 |
| Q |
175 |
ctttggcatt |
184 |
Q |
| |
|
||||| |||| |
|
|
| T |
41071169 |
ctttgccatt |
41071178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #78
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 64 - 184
Target Start/End: Complemental strand, 9640663 - 9640546
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| ||||||| ||||||||||| ||| |||||||||||| |||| || | |||| ||||||||| ||||||||||||| ||||||||| |
|
|
| T |
9640663 |
atccagaagtcatagctcaactggcaaaatgccgatattgttaggccga---atgctataatcgggattcgaaccccggtacctccacttatgtgtgtga |
9640567 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
9640566 |
gtttataatggctttgccatt |
9640546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #79
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 88 - 184
Target Start/End: Complemental strand, 20695588 - 20695495
Alignment:
| Q |
88 |
caaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||| ||||||||||||||| | ||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
20695588 |
caaaatgccgaaattgttaggcccg---atgtcatgaccggggttcgaacccctatacctccacttgtgtgtgtgagtttataatggctttgccatt |
20695495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #80
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 64 - 184
Target Start/End: Complemental strand, 29293651 - 29293534
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
||||| ||||||||| | | ||||||| || ||||||||||||||||| ||||||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29293651 |
atccaaaagttctagttgaattggcaaagtgccgaaattgttaggccgg---atgccatgatcggggttcgaacctcggtacctccacttgtgtgtgtga |
29293555 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
||| ||||| |||||| |||| |
|
|
| T |
29293554 |
gttcataatagctttgccatt |
29293534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #81
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 59 - 184
Target Start/End: Original strand, 32466563 - 32466687
Alignment:
| Q |
59 |
tttatatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccact--tgtg |
156 |
Q |
| |
|
||||||||||||||| |||| ||| ||| |||||||||||||| |||||| ||||||| |||||||| |||||||||| | |||||||||| |||| |
|
|
| T |
32466563 |
tttatatccagaagtcctagttcaactgataaaatgtcgaaattattaggc---cggatgctatgaccggagttcgaaccccgatacctccacttatgtg |
32466659 |
T |
 |
| Q |
157 |
tgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||| ||||||||||||||| |||| |
|
|
| T |
32466660 |
tgtgtgaatttataatggctttgtcatt |
32466687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #82
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 89 - 184
Target Start/End: Complemental strand, 972698 - 972606
Alignment:
| Q |
89 |
aaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||||||| ||| |||| |||||| |||||||||||| |||||||| |||||||||||||||||||||||| ||||| |||| |
|
|
| T |
972698 |
aaaatgtcgaaattgttaggtcgg---atgctatgaccagggttcgaaccccggtacctctacttgtgtgtgtgagtttataatgactttgtcatt |
972606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #83
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 62 - 184
Target Start/End: Complemental strand, 19836218 - 19836099
Alignment:
| Q |
62 |
atatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgt |
161 |
Q |
| |
|
|||| ||||||| |||||||| |||||||||||||||||||||||| | ||||||| |||||||| || | | || |||||||||||||||| |||| |
|
|
| T |
19836218 |
atattcagaagtcctagctcaactggcaaaatgtcgaaattgttag---gtcggatgctgtgaccgggatttgtatcccggtacctccacttgtgcgtgt |
19836122 |
T |
 |
| Q |
162 |
gagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||| ||||| |||| |
|
|
| T |
19836121 |
gagtttataatgactttgtcatt |
19836099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #84
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 63 - 184
Target Start/End: Original strand, 23310398 - 23310514
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| |||||||| |||||||||| | ||||||||||||||| ||||||||||| | |||| ||||| |||||||||||| |||||||| |
|
|
| T |
23310398 |
tatccagaagtcctagctcaactggcaaaataccaaaattgttaggccgg---atgccatgaccagagttcaaaccccggtacctccact--tgtgtgtg |
23310492 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
| ||||||||||||||| |||| |
|
|
| T |
23310493 |
aatttataatggctttgccatt |
23310514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #85
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 97 - 179
Target Start/End: Original strand, 29622237 - 29622315
Alignment:
| Q |
97 |
gaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttg |
179 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| | ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
29622237 |
gaaattgttaggccgg---atgccatgaccggggttcgaaccccg-tacctccacttatgtgtgtgagtttataatggctttg |
29622315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #86
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 64 - 174
Target Start/End: Complemental strand, 42337972 - 42337865
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||| | |||||||| ||||||||||| ||||||||||||| ||| ||| ||| | ||| |||||||| ||||||||||||||||||||||||| |
|
|
| T |
42337972 |
atccagaattcctagctcaactggcaaaatgccgaaattgttaggtcgg---atgtcataatcggagttcgaactctggtacctccacttgtgtgtgtga |
42337876 |
T |
 |
| Q |
164 |
gtttataatgg |
174 |
Q |
| |
|
|||||| |||| |
|
|
| T |
42337875 |
gtttatgatgg |
42337865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #87
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 70 - 184
Target Start/End: Complemental strand, 43070807 - 43070696
Alignment:
| Q |
70 |
aagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttat |
169 |
Q |
| |
|
|||| |||||| | ||||||||||| ||||||||||||| ||| |||||||||| | ||||||||||| ||| ||||||||| ||||||||||||||| |
|
|
| T |
43070807 |
aagtactagcttaactggcaaaatgccgaaattgttaggtcgg---atgccatgacggaggttcgaaccccggttcctccacttatgtgtgtgagtttat |
43070711 |
T |
 |
| Q |
170 |
aatggctttggcatt |
184 |
Q |
| |
|
|||| ||||| |||| |
|
|
| T |
43070710 |
aatgactttgccatt |
43070696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #88
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 68 - 184
Target Start/End: Complemental strand, 10154287 - 10154176
Alignment:
| Q |
68 |
agaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagttt |
167 |
Q |
| |
|
|||||| ||| |||| ||| ||||||| ||||||||| ||||||| |||||||||||||||||||||||| ||||| |||||||||| ||||||||| |
|
|
| T |
10154287 |
agaagtcctaactcaactgacaaaatgccgaaattgtcaggccgg---atgccatgaccggggttcgaaccccggtacttccacttgtg--tgtgagttt |
10154193 |
T |
 |
| Q |
168 |
ataatggctttggcatt |
184 |
Q |
| |
|
||| |||||||| |||| |
|
|
| T |
10154192 |
atattggctttgccatt |
10154176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #89
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 63 - 184
Target Start/End: Original strand, 28869949 - 28870066
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
|||||||||||||| ||||| || ||||| | ||||||||||||||||| ||| ||| ||| || ||||||||||||| |||||||||||||||||| |
|
|
| T |
28869949 |
tatccagaagttctggctcaactagcaaa-tatcgaaattgttaggccga---atgtcataacctggattcgaaccctggtccctccacttgtgtgtgtg |
28870044 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||| |||| |||| |
|
|
| T |
28870045 |
agtttataatggttttgtcatt |
28870066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #90
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 63 - 178
Target Start/End: Complemental strand, 25567813 - 25567700
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaa-tgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgt |
161 |
Q |
| |
|
|||||| |||| |||| ||| ||||||||| || |||||| ||||||||| ||||||||| |||||||||||||| | ||||||||||| ||||||| |
|
|
| T |
25567813 |
tatccataagtcctagttcaactggcaaaaatgctgaaattattaggccgg---atgccatgatcggggttcgaaccccgttacctccacttctgtgtgt |
25567717 |
T |
 |
| Q |
162 |
gagtttataatggcttt |
178 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
25567716 |
gagtttataatggcttt |
25567700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #91
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 115 - 184
Target Start/End: Original strand, 9716334 - 9716403
Alignment:
| Q |
115 |
gatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |||||||| ||| ||||||||||||||||| |||| |
|
|
| T |
9716334 |
gatgccatgaccggggttcgaaccccggtacctctacttgtgtctgtaagtttataatggctttgtcatt |
9716403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #92
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 97 - 184
Target Start/End: Original strand, 14126935 - 14127019
Alignment:
| Q |
97 |
gaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||| || ||||||||||||||||| || |||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
14126935 |
gaaattgttaggccgg---atctcatgaccggggttcgaatcccggtacctccacttgtgtgtgcgagtttataatggctttgtcatt |
14127019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #93
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 64 - 174
Target Start/End: Complemental strand, 12769254 - 12769147
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
||||| |||| |||||||| |||| |||||| ||||||||||||| ||| ||||||| ||| | |||||||||| ||||||||||||||||||||| |
|
|
| T |
12769254 |
atccaaaagtcctagctcaactggtaaaatgccgaaattgttaggtcgg---atgccatcaccagagttcgaaccccaatacctccacttgtgtgtgtga |
12769158 |
T |
 |
| Q |
164 |
gtttataatgg |
174 |
Q |
| |
|
||||||||||| |
|
|
| T |
12769157 |
gtttataatgg |
12769147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #94
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 63 - 184
Target Start/End: Original strand, 37067699 - 37067814
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
|||| |||||| ||| |||| ||| ||||||| |||||||||||||| |||||||||||||||| |||||||||| ||||||||||| |||||||| |
|
|
| T |
37067699 |
tatctagaagtcctacctcaactgacaaaatgccgaaattgttaggc---cggatgccatgaccggagttcgaaccc-cgtacctccact--tgtgtgtg |
37067792 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||| ||||| |||| |
|
|
| T |
37067793 |
agtttataatgactttgccatt |
37067814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #95
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 113 - 184
Target Start/End: Complemental strand, 6219273 - 6219203
Alignment:
| Q |
113 |
cggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||| ||||||||| |||||||||||||||| |||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
6219273 |
cggatgtcatgaccggtgttcgaaccctggtac-tccatttgtgtgtgtgagtttataatggctttgccatt |
6219203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #96
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 63 - 184
Target Start/End: Original strand, 14808833 - 14808951
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| ||| ||| ||||||||||| | ||||||||||||||| || |||||||| |||||||||| | |||| |||||||| |||||||| |
|
|
| T |
14808833 |
tatccagaagtcctaattcaactggcaaaatgccaaaattgttaggccgg---atcccatgaccagggttcgaactccggtatctccacttatgtgtgtg |
14808929 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||| |||| |
|
|
| T |
14808930 |
gatttataatggctttgccatt |
14808951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #97
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 75 - 179
Target Start/End: Original strand, 8487407 - 8487508
Alignment:
| Q |
75 |
ctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatgg |
174 |
Q |
| |
|
|||||||| ||||||||||| | ||||||||| || || ||| ||||||||||||| ||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
8487407 |
ctagctcaactggcaaaatgccaaaattgttaagctgg---atgtcatgaccggggtttgaatctcggtacctccacttgtgtgtgtgagtttataatgg |
8487503 |
T |
 |
| Q |
175 |
ctttg |
179 |
Q |
| |
|
|||| |
|
|
| T |
8487504 |
ttttg |
8487508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #98
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 63 - 184
Target Start/End: Original strand, 10011468 - 10011588
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccact--tgtgtgtg |
160 |
Q |
| |
|
|||||| |||| |||||||| | || ||||||||||||||||||| | |||||||||||| ||| |||||||| | |||||||||||| ||| |||| |
|
|
| T |
10011468 |
tatccaaaagtcctagctcaaccggtaaaatgtcgaaattgttag---gtcggatgccatgatcggagttcgaactccggtacctccacttatgtatgtg |
10011564 |
T |
 |
| Q |
161 |
tgagtttataatggctttggcatt |
184 |
Q |
| |
|
||| ||||||||||||||| |||| |
|
|
| T |
10011565 |
tgaatttataatggctttgtcatt |
10011588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #99
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 64 - 160
Target Start/End: Original strand, 14107251 - 14107344
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtg |
160 |
Q |
| |
|
||||| |||| |||||||| ||| |||||| ||||| ||||||||||| |||||||||||||||||||||||| ||||||||||||| |||||| |
|
|
| T |
14107251 |
atccacaagtcctagctcaattggtaaaatgccgaaactgttaggccgg---atgccatgaccggggttcgaaccccggtacctccacttatgtgtg |
14107344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #100
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 62 - 178
Target Start/End: Original strand, 24637951 - 24638064
Alignment:
| Q |
62 |
atatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgt |
161 |
Q |
| |
|
|||||| |||||||||||||| || ||||||| |||||||||||||||| ||| ||||| ||||||||||||| ||| || ||||||||||||| |
|
|
| T |
24637951 |
atatcctgaagttctagctcaattgataaaatgttgaaattgttaggccgg---atgtcatgattggggttcgaaccccggtttcttcacttgtgtgtgt |
24638047 |
T |
 |
| Q |
162 |
gagtttataatggcttt |
178 |
Q |
| |
|
|||||||||||| |||| |
|
|
| T |
24638048 |
gagtttataatgacttt |
24638064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #101
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 68 - 174
Target Start/End: Complemental strand, 6053176 - 6053075
Alignment:
| Q |
68 |
agaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagttt |
167 |
Q |
| |
|
|||||| |||||||| ||| ||||||| ||||||||||||| ||| ||| |||||||||||||||||||| |||||||||||| | | ||||||||| |
|
|
| T |
6053176 |
agaagtcctagctcaactgacaaaatgccgaaattgttaggtcgg---atgtcatgaccggggttcgaaccccggtacctccact--tatatgtgagttt |
6053082 |
T |
 |
| Q |
168 |
ataatgg |
174 |
Q |
| |
|
||||||| |
|
|
| T |
6053081 |
ataatgg |
6053075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #102
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 65 - 184
Target Start/End: Complemental strand, 12638596 - 12638481
Alignment:
| Q |
65 |
tccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgag |
164 |
Q |
| |
|
|||| |||| |||||||| || | ||||| |||||||||||||||||| | ||| |||| ||||||||||||| | | |||||||||||||||||||| |
|
|
| T |
12638596 |
tccaaaagtcctagctcaactagtaaaatatcgaaattgttaggccgg---acgccttgacgggggttcgaaccccg-tccctccacttgtgtgtgtgag |
12638501 |
T |
 |
| Q |
165 |
tttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||| |||| |||| |
|
|
| T |
12638500 |
tttataatggttttgccatt |
12638481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #103
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 62 - 173
Target Start/End: Original strand, 17080462 - 17080570
Alignment:
| Q |
62 |
atatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgt |
161 |
Q |
| |
|
|||| ||||||| ||||||| ||| ||||||||||||||||||| | |||||| |||||| |||||||||||| ||||||||||||| ||||||| |
|
|
| T |
17080462 |
atattcagaagtcgtagctcaactgacaaaatgtcgaaattgtta---agtcggatgtcatgacgggggttcgaacctcggtacctccacttatgtgtgt |
17080558 |
T |
 |
| Q |
162 |
gagtttataatg |
173 |
Q |
| |
|
|| ||||||||| |
|
|
| T |
17080559 |
gaatttataatg |
17080570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #104
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 75 - 184
Target Start/End: Complemental strand, 32274094 - 32273990
Alignment:
| Q |
75 |
ctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatgg |
174 |
Q |
| |
|
|||| ||| ||||||||||| |||||||||||| |||||| ||||||||||||||||||||| |||| |||| || ||||||||||||||||||| |
|
|
| T |
32274094 |
ctagttcaactggcaaaatgctgaaattgttagg---gcggataccatgaccggggttcgaaccccggtaactccgct--tgtgtgtgagtttataatga |
32274000 |
T |
 |
| Q |
175 |
ctttggcatt |
184 |
Q |
| |
|
||||| |||| |
|
|
| T |
32273999 |
ctttgtcatt |
32273990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #105
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 78 - 179
Target Start/End: Complemental strand, 1931204 - 1931106
Alignment:
| Q |
78 |
gctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctt |
177 |
Q |
| |
|
||||| ||| ||||||||||||||||||||||||| |||| ||||| |||||||||||| ||| |||||||||||||||| | ||||||||| ||| |
|
|
| T |
1931204 |
gctcaactgacaaaatgtcgaaattgttaggccgg---atgctatgactggggttcgaacctcagtatctccacttgtgtgtgtaaatttataatgactt |
1931108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #106
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 70 - 184
Target Start/End: Complemental strand, 27004088 - 27003975
Alignment:
| Q |
70 |
aagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccact--tgtgtgtgtgagttt |
167 |
Q |
| |
|
|||| |||||||| |||| |||||| |||||||||||| | ||||||||||| ||||||||||| || || ||||||||| ||||||||||||||| |
|
|
| T |
27004088 |
aagtcctagctcaactggtaaaatgccgaaattgttagtc---tggatgccatgatcggggttcgaatcccggcacctccacttatgtgtgtgtgagttt |
27003992 |
T |
 |
| Q |
168 |
ataatggctttggcatt |
184 |
Q |
| |
|
|||||| ||||| |||| |
|
|
| T |
27003991 |
ataatgactttgtcatt |
27003975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #107
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 117 - 184
Target Start/End: Complemental strand, 41958108 - 41958041
Alignment:
| Q |
117 |
tgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||| ||||||||||| |||||||| |||||||||||| ||||||||||||||||| |||| |
|
|
| T |
41958108 |
tgccatgaccagggttcgaacctcggtacctctacttgtgtgtgttagtttataatggctttgccatt |
41958041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #108
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 61 - 184
Target Start/End: Original strand, 4228853 - 4228971
Alignment:
| Q |
61 |
tatatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtg |
160 |
Q |
| |
|
|||||||| || | |||||||| |||||||||||||||||||||||| | || || |||||| |||||||| ||||| |||| |||||| | |||| |
|
|
| T |
4228853 |
tatatccataaatcctagctcaactggcaaaatgtcgaaattgttagac---cgaataccatgatcggggttccaaccccggtatttccact--tatgtg |
4228947 |
T |
 |
| Q |
161 |
tgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||||| |||| |
|
|
| T |
4228948 |
tgagtttataatggctttgccatt |
4228971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #109
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 89 - 184
Target Start/End: Complemental strand, 4874349 - 4874257
Alignment:
| Q |
89 |
aaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||||||| ||| ||| |||| |||||||||||||| | |||||||| || ||| ||||||||||||||||||||| |||| |
|
|
| T |
4874349 |
aaaatgtcgaaattgttaggacgg---atgttatgatcggggttcgaaccccgatacctccatttatgtatgtgagtttataatggctttgccatt |
4874257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #110
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 111 - 184
Target Start/End: Original strand, 7809618 - 7809691
Alignment:
| Q |
111 |
ggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||| ||||| |||||||| |||||| ||||||| |||| |||||||||||||||||||| |||| |||| |
|
|
| T |
7809618 |
ggcggatgtcatgatcggggttcaaaccctagtacctcaacttatgtgtgtgagtttataatggttttgtcatt |
7809691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #111
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 115 - 184
Target Start/End: Complemental strand, 16667112 - 16667043
Alignment:
| Q |
115 |
gatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||||||||| |||||| |||| ||||||| ||||| |||| |
|
|
| T |
16667112 |
gatgccatgatcggggttcgaaccccggtacctccacttctgtgtgagagtatataatgactttgccatt |
16667043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #112
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 118 - 179
Target Start/End: Original strand, 39955743 - 39955804
Alignment:
| Q |
118 |
gccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttg |
179 |
Q |
| |
|
|||||||| ||||| ||||||| ||||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
39955743 |
gccatgactggggtgcgaaccccggtacttccacttgtgtgtgtgagtttataatgactttg |
39955804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #113
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 113 - 173
Target Start/End: Complemental strand, 2025764 - 2025704
Alignment:
| Q |
113 |
cggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatg |
173 |
Q |
| |
|
|||||| ||||| |||||||||||| | ||||||||||||| ||||||||||||||||||| |
|
|
| T |
2025764 |
cggatgtcatgatcggggttcgaactccggtacctccacttatgtgtgtgagtttataatg |
2025704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #114
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 89 - 184
Target Start/End: Complemental strand, 10109995 - 10109907
Alignment:
| Q |
89 |
aaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||| ||||||||||||| ||| |||||||| |||||||||| |||||||||||||| ||||||||||||||||||||| |||| |
|
|
| T |
10109995 |
aaaatgtcgatattgttaggccgg---atgtcatgaccgaggttcgaacctcggtacctccacttg----tgtgagtttataatggctttgccatt |
10109907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #115
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 67 - 184
Target Start/End: Original strand, 10458728 - 10458843
Alignment:
| Q |
67 |
cagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgt-gagt |
165 |
Q |
| |
|
||||||| ||| |||| ||| |||||| | ||||||||||||||| |||| |||| |||||||||||||| ||||||||||||||| ||||| || | |
|
|
| T |
10458728 |
cagaagtcctaactcaattggtaaaatgccaaaattgttaggccgg---atgctatgatcggggttcgaaccccggtacctccacttgtatgtgtggatt |
10458824 |
T |
 |
| Q |
166 |
ttataatggctttggcatt |
184 |
Q |
| |
|
|||||||| ||||| |||| |
|
|
| T |
10458825 |
ttataatgactttgtcatt |
10458843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #116
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 89 - 159
Target Start/End: Complemental strand, 15067244 - 15067177
Alignment:
| Q |
89 |
aaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgt |
159 |
Q |
| |
|
|||||||||||||||||||||||| |||| |||| |||||||||||||| ||||| ||||||||||||| |
|
|
| T |
15067244 |
aaaatgtcgaaattgttaggccgg---atgctatgatcggggttcgaaccccggtacatccacttgtgtgt |
15067177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #117
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 120 - 184
Target Start/End: Complemental strand, 19867357 - 19867293
Alignment:
| Q |
120 |
catgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||||||| |||||| ||||| ||||||||||||||||||| ||||| |||| |
|
|
| T |
19867357 |
catgaccggggttcgaaccccagtaccttcacttatgtgtgtgagtttataatgactttgtcatt |
19867293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #118
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 113 - 184
Target Start/End: Original strand, 5276392 - 5276462
Alignment:
| Q |
113 |
cggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||||| ||||||| || ||||||||||||||||||||||| ||||| ||||| |||| |
|
|
| T |
5276392 |
cggatgccatgaccggggt-cgaaccccggctcctccacttgtgtgtgtgagtttctaatgactttgccatt |
5276462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #119
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 63 - 184
Target Start/End: Complemental strand, 13549281 - 13549164
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||| || ||||||| ||||||||||||| ||||| |||||| ||||| |||||| ||||||||||||| |||||||||||| || | || |
|
|
| T |
13549281 |
tatccagaaattatagctcaactggcaaaatgtcaaaatttttaggc---cggatatcatgacaggggttcgaaccc-cgtacctccacttatgcatttg |
13549186 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
|||||| |||||||||| |||| |
|
|
| T |
13549185 |
agtttaaaatggctttgccatt |
13549164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #120
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 75 - 184
Target Start/End: Complemental strand, 40199222 - 40199116
Alignment:
| Q |
75 |
ctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatgg |
174 |
Q |
| |
|
|||||||| ||| |||||| |||||||||||||| || ||| ||||| || |||||||||| ||||||||||||| ||| |||||||||||||||| |
|
|
| T |
40199222 |
ctagctcaactgataaaatgccgaaattgttaggctgg---atgtcatgatcgaagttcgaaccccggtacctccacttatgtatgtgagtttataatgg |
40199126 |
T |
 |
| Q |
175 |
ctttggcatt |
184 |
Q |
| |
|
|||| |||| |
|
|
| T |
40199125 |
ttttgccatt |
40199116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #121
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 89 - 184
Target Start/End: Original strand, 1612397 - 1612490
Alignment:
| Q |
89 |
aaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttata-atggctttggcatt |
184 |
Q |
| |
|
||||||| |||||||||||||||| | ||| |||| ||||||||||| | |||||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
1612397 |
aaaatgttgaaattgttaggccgg---acatcataaccgcggttcgaaccccgatacctccacttgtgtgtgtgagtttatatatggctttgtcatt |
1612490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #122
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 67 - 178
Target Start/End: Complemental strand, 12819671 - 12819564
Alignment:
| Q |
67 |
cagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtt |
166 |
Q |
| |
|
||||||| ||| |||| ||| |||||| ||||||||||||| ||| |||||| |||| |||| ||||| ||||||| ||||||| |||||||||| |
|
|
| T |
12819671 |
cagaagtcctaactcaattggtaaaatgccgaaattgttaggtcgg----tgccataaccgtggtttgaacctcggtaccttcacttgtatgtgtgagtt |
12819576 |
T |
 |
| Q |
167 |
tataatggcttt |
178 |
Q |
| |
|
|||||||||||| |
|
|
| T |
12819575 |
tataatggcttt |
12819564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #123
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 64 - 172
Target Start/End: Complemental strand, 31895640 - 31895536
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
||||||||||||||| ||| ||| |||| || |||||||||||||| || ||| |||||| ||||||||||| ||||||||||||||||||| || |
|
|
| T |
31895640 |
atccagaagttctagatcaactgccaaa-tgccgaaattgttaggcagg---atgtcatgactaaggttcgaaccccggtacctccacttgtgtgtatgg |
31895545 |
T |
 |
| Q |
164 |
gtttataat |
172 |
Q |
| |
|
||||||||| |
|
|
| T |
31895544 |
gtttataat |
31895536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #124
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 113 - 184
Target Start/End: Complemental strand, 42645548 - 42645475
Alignment:
| Q |
113 |
cggatgccatgaccggggttcgaaccctggtacctccact--tgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||| ||||| ||||||||||||| |||||||||||| ||| ||||||||||||||||||||||| |||| |
|
|
| T |
42645548 |
cggatgtcatgatcggggttcgaacctcggtacctccacttatgtatgtgtgagtttataatggctttgtcatt |
42645475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #125
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 88 - 179
Target Start/End: Complemental strand, 42559934 - 42559846
Alignment:
| Q |
88 |
caaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttg |
179 |
Q |
| |
|
||||||||||||||||||||||||| ||| |||| || ||||| || | ||||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
42559934 |
caaaatgtcgaaattgttaggccgg---atgtaatgatcgaggttcaaattccggtacctccacttatgtgtgtgagtttataatggttttg |
42559846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #126
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 63 - 184
Target Start/End: Complemental strand, 13550379 - 13550261
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccgggg-ttcgaaccctggtacctccacttgtgtgtgt |
161 |
Q |
| |
|
||||||||| | |||||||| | |||||||||| || ||| |||||| || || |||||||||||| ||||||||| | ||||||||||||||||||| |
|
|
| T |
13550379 |
tatccagaaatcctagctcaacgggcaaaatgttgagatttttaggctgg---ataccatgaccgggggttcgaaccccg-tacctccacttgtgtgtgt |
13550284 |
T |
 |
| Q |
162 |
gagtttataatggctttggcatt |
184 |
Q |
| |
|
|| ||| |||||||||| |||| |
|
|
| T |
13550283 |
cagattaaaatggctttgccatt |
13550261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #127
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 63 - 184
Target Start/End: Complemental strand, 2706260 - 2706142
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| |||||| | |||| |||||| ||||||| ||||| | | |||| |||| || |||||||| | | ||||| |||||||||||||| |
|
|
| T |
2706260 |
tatccagaagtcctagcttaactggtaaaatgccgaaattattaggtcag---atgctatgattggagttcgaactccgataccttcacttgtgtgtgtg |
2706164 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
| ||||||||||||||| |||| |
|
|
| T |
2706163 |
aatttataatggctttgtcatt |
2706142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #128
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 114 - 184
Target Start/End: Complemental strand, 9722156 - 9722086
Alignment:
| Q |
114 |
ggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||| |||||| |||||||||||| | |||||||| ||||||||||| ||||||| |||| ||||| |||| |
|
|
| T |
9722156 |
ggataccatgatcggggttcgaacaccggtacctctacttgtgtgtgagagtttaaaatgactttgtcatt |
9722086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #129
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 121 - 175
Target Start/End: Original strand, 12262924 - 12262978
Alignment:
| Q |
121 |
atgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggc |
175 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||||||||||| |||| |||||| |
|
|
| T |
12262924 |
atgatcggggttcgaacccaagtacctccacttgtgtgtgtgactttacaatggc |
12262978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #130
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 62 - 184
Target Start/End: Complemental strand, 23219251 - 23219126
Alignment:
| Q |
62 |
atatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacc-tccac-----ttgt |
155 |
Q |
| |
|
|||| ||||||| ||| |||| |||| |||||| | |||||||||||| || ||||||||| ||||||||||||| |||||| ||||| |||| |
|
|
| T |
23219251 |
atatgcagaagtcctaactcaactggtaaaatgccaaaattgttaggc---cgtatgccatgatcggggttcgaacctcggtaccttccacttgtgttgt |
23219155 |
T |
 |
| Q |
156 |
gtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||||| ||||| |||| |
|
|
| T |
23219154 |
gtgtgtgagtttataatgactttgtcatt |
23219126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #131
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 143 - 184
Target Start/End: Complemental strand, 17986107 - 17986066
Alignment:
| Q |
143 |
tacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| |||| |
|
|
| T |
17986107 |
tacctccacttgtgtgtgtgagtttataatagctttgtcatt |
17986066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #132
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 127 - 184
Target Start/End: Original strand, 35232602 - 35232659
Alignment:
| Q |
127 |
ggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||| |||| | ||||| ||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
35232602 |
ggggttcggaccccgataccttcacttgtgtgtgtgagtttataatgactttgtcatt |
35232659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #133
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 79 - 174
Target Start/End: Original strand, 42653555 - 42653647
Alignment:
| Q |
79 |
ctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatgg |
174 |
Q |
| |
|
|||| ||| |||||||||||||||||||| | |||||| ||||||||||||| |||| | || |||||||| |||||||||||||| ||||| |
|
|
| T |
42653555 |
ctcaactgacaaaatgtcgaaattgttagac---cggatgtcatgaccggggtttgaacttcgatatctccacttatgtgtgtgagtttaaaatgg |
42653647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #134
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 64 - 112
Target Start/End: Complemental strand, 22620780 - 22620732
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccgg |
112 |
Q |
| |
|
|||||||||| |||||||| ||| ||||||| ||||||||||||||||| |
|
|
| T |
22620780 |
atccagaagtcctagctcaactgacaaaatgccgaaattgttaggccgg |
22620732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #135
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 118 - 173
Target Start/End: Original strand, 29402062 - 29402115
Alignment:
| Q |
118 |
gccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatg |
173 |
Q |
| |
|
|||||||| | ||||||||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
29402062 |
gccatgactgaggttcgaaccccggtacctccact--tgtgtgtgagtttataatg |
29402115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #136
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 121 - 173
Target Start/End: Complemental strand, 35933052 - 35933000
Alignment:
| Q |
121 |
atgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatg |
173 |
Q |
| |
|
|||| |||||||||||||| |||| ||||||| ||||||||||||||||||| |
|
|
| T |
35933052 |
atgatcggggttcgaaccccagtacttccacttatgtgtgtgagtttataatg |
35933000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #137
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 120 - 179
Target Start/End: Original strand, 27389711 - 27389770
Alignment:
| Q |
120 |
catgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttg |
179 |
Q |
| |
|
||||| ||||||| ||||| | ||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
27389711 |
catgatcggggtttaaaccccgatacctccacttatgtgtgtgagtttataatgactttg |
27389770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #138
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 18990610 - 18990552
Alignment:
| Q |
120 |
catgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggcttt |
178 |
Q |
| |
|
|||||||||||||||||||| | || || || ||||| |||||||||||||||| |||| |
|
|
| T |
18990610 |
catgaccggggttcgaaccccgatatctacatttgtgcgtgtgagtttataatgacttt |
18990552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #139
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 142 - 184
Target Start/End: Complemental strand, 26310802 - 26310760
Alignment:
| Q |
142 |
gtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
26310802 |
gtaccttcacttgtgtgtgtgagtttataatgactttgtcatt |
26310760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #140
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 61 - 111
Target Start/End: Complemental strand, 37142158 - 37142108
Alignment:
| Q |
61 |
tatatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccg |
111 |
Q |
| |
|
||||||||||||| |||||| | ||||||||||| ||||||||||||||| |
|
|
| T |
37142158 |
tatatccagaagtcctagcttaactggcaaaatgctgaaattgttaggccg |
37142108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #141
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 62 - 153
Target Start/End: Original strand, 19090431 - 19090519
Alignment:
| Q |
62 |
atatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccactt |
153 |
Q |
| |
|
|||||||||||| ||||||| |||| |||||||| |||||||||||| | |||||||| ||| |||||||||| | ||||||||||| |
|
|
| T |
19090431 |
atatccagaagtcttagctcaactggtaaaatgtcaaaattgttaggc---cagatgccataacctaggttcgaacctcgatacctccactt |
19090519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #142
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 70 - 184
Target Start/End: Original strand, 22963693 - 22963802
Alignment:
| Q |
70 |
aagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttat |
169 |
Q |
| |
|
||||||||||||| ||| ||||||| |||||| ||||| ||| || |||||| | |||||||||||| ||||||||||| | ||||||||||| |
|
|
| T |
22963693 |
aagttctagctcaactgacaaaatgctgaaattattaggtcgg---ataccatgatcagggttcgaaccccagtacctccact--tacatgtgagtttat |
22963787 |
T |
 |
| Q |
170 |
aatggctttggcatt |
184 |
Q |
| |
|
|||||||||| |||| |
|
|
| T |
22963788 |
aatggctttgccatt |
22963802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #143
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 68 - 179
Target Start/End: Original strand, 34174323 - 34174431
Alignment:
| Q |
68 |
agaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagttt |
167 |
Q |
| |
|
|||||| |||||||| |||| |||||| | |||||||||| |||| |||||||||| | ||||| ||| | |||| || || |||| | ||||||||| |
|
|
| T |
34174323 |
agaagtcctagctcaactggtaaaatgacaaaattgttagaccgg---atgccatgactgaggttcaaactccggtatcttcatttgtatatgtgagttt |
34174419 |
T |
 |
| Q |
168 |
ataatggctttg |
179 |
Q |
| |
|
|||||| ||||| |
|
|
| T |
34174420 |
ataatgactttg |
34174431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #144
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 145 - 178
Target Start/End: Original strand, 39916540 - 39916573
Alignment:
| Q |
145 |
cctccacttgtgtgtgtgagtttataatggcttt |
178 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |
|
|
| T |
39916540 |
cctccacttgtgtgtgtgagtttataatgacttt |
39916573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #145
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 123 - 175
Target Start/End: Complemental strand, 8595553 - 8595502
Alignment:
| Q |
123 |
gaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggc |
175 |
Q |
| |
|
||||||||||||||||| ||||||||||||| ||| |||||| |||| ||||| |
|
|
| T |
8595553 |
gaccggggttcgaaccccggtacctccactt-tgtatgtgaggttatgatggc |
8595502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #146
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 120 - 179
Target Start/End: Complemental strand, 10084005 - 10083945
Alignment:
| Q |
120 |
catgaccggggttcgaaccctggtacctccac-ttgtgtgtgtgagtttataatggctttg |
179 |
Q |
| |
|
|||||||||||||||||| | |||| |||||| |||||||||| ||||||| ||| ||||| |
|
|
| T |
10084005 |
catgaccggggttcgaactccggtagctccactttgtgtgtgtaagtttatgatgactttg |
10083945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #147
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 152 - 184
Target Start/End: Complemental strand, 40529383 - 40529351
Alignment:
| Q |
152 |
ttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |
|
|
| T |
40529383 |
ttgtgtgtgtgagtttataatggctttgtcatt |
40529351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 92; Significance: 1e-44; HSPs: 116)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 63 - 184
Target Start/End: Complemental strand, 35476620 - 35476502
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
35476620 |
tatccagaagtcctagctcaactggcaaaatgtcgaaattgttaggccgg---atgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtg |
35476524 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
35476523 |
agtttataatggctttgccatt |
35476502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 64 - 184
Target Start/End: Complemental strand, 20251614 - 20251497
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| ||||||||||| ||||||||||||||||| ||||||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
20251614 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccgg---atgccatgatcggggttcgaaccccggtacctccacttgtgtgtgtga |
20251518 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
20251517 |
gtttataatggctttgccatt |
20251497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 64 - 184
Target Start/End: Complemental strand, 36754870 - 36754753
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| ||||||||||| ||||||||||||||||| |||| ||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
36754870 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccgg---atgctatgaccggggttcgaaccccggtacctccacttgtgtgtgtga |
36754774 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
36754773 |
gtttataatggctttgccatt |
36754753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 65 - 184
Target Start/End: Original strand, 39070019 - 39070135
Alignment:
| Q |
65 |
tccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgag |
164 |
Q |
| |
|
||||||||| |||||||| |||| |||||| ||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
39070019 |
tccagaagtcctagctcaactggtaaaatgccgaaattgttaggccgg---atgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgag |
39070115 |
T |
 |
| Q |
165 |
tttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||| |||| |
|
|
| T |
39070116 |
tttataatggctttgccatt |
39070135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 63 - 184
Target Start/End: Complemental strand, 13268105 - 13267987
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| |||||||| ||||||||||| ||||||||||||| ||| ||| |||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
13268105 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggtcgg---atgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtg |
13268009 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
13268008 |
agtttataatggctttgccatt |
13267987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 63 - 184
Target Start/End: Original strand, 23957050 - 23957168
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||| ||| ||||| |||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
23957050 |
tatccagaagttctagctcaactggcaaaatgtcgaaattgttaggccgg---atgtcatgatcggggttcgaaccccggtacctccacttatgtgtgtg |
23957146 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
||||| ||||||||||| |||| |
|
|
| T |
23957147 |
agtttttaatggctttgtcatt |
23957168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 67 - 184
Target Start/End: Complemental strand, 43461460 - 43461346
Alignment:
| Q |
67 |
cagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtt |
166 |
Q |
| |
|
||||||| |||||||| |||| |||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
43461460 |
cagaagtcctagctcaactggtaaaatgtcgaaattgttaggccgg---atgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtt |
43461364 |
T |
 |
| Q |
167 |
tataatggctttggcatt |
184 |
Q |
| |
|
||||||| ||||| |||| |
|
|
| T |
43461363 |
tataatgactttgtcatt |
43461346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 63 - 184
Target Start/End: Original strand, 44948017 - 44948135
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| |||||||| ||| ||||||||||||||||||||||||| |||||||||||||||||||||| | ||||||||||||||| |||||| |
|
|
| T |
44948017 |
tatccagaagtcctagctcaactgacaaaatgtcgaaattgttaggccgg---atgccatgaccggggttcgaactccggtacctccacttgtatgtgtg |
44948113 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
44948114 |
agtttataatggctttgccatt |
44948135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 63 - 184
Target Start/End: Original strand, 45049383 - 45049501
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||||||||||||||||| ||| ||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
45049383 |
tatccagaagtcttagctcaactggcaaaatgtcgaaattgttaggccgg---atgtcatgaccggggttcgaatcccggtacctccacttgtgtgtgtg |
45049479 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
45049480 |
agtttataatggctttgccatt |
45049501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 79; E-Value: 7e-37
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 12236120 - 12236237
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| |||| |||||| ||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
12236120 |
atccagaagtcctagctcaactggtaaaatgccgaaattgttaggccgg---atgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtga |
12236216 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||| |||| |
|
|
| T |
12236217 |
atttataatggctttgccatt |
12236237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 79; E-Value: 7e-37
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 15897213 - 15897330
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| ||||||||||| ||||||||||||||||| ||| |||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
15897213 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccgg---atgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtga |
15897309 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||| ||||| |||| |
|
|
| T |
15897310 |
gtttataatgcctttgccatt |
15897330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 79; E-Value: 7e-37
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 34667043 - 34667160
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| ||||||||||| ||||||||||||||||| ||| ||||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
34667043 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccgg---atgtcatgaccggagttcgaaccccggtacctccacttgtgtgtgtga |
34667139 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
34667140 |
gtttataatggctttgccatt |
34667160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 58 - 184
Target Start/End: Original strand, 33607036 - 33607159
Alignment:
| Q |
58 |
atttatatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgt |
157 |
Q |
| |
|
|||| ||||||||||| |||||||| ||||||||||| ||||||||||||||| | |||||||||| ||||||||||||| | ||||||||||||||| |
|
|
| T |
33607036 |
atttctatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccag---atgccatgactggggttcgaaccccgatacctccacttgtgt |
33607132 |
T |
 |
| Q |
158 |
gtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||||||||| |||| |
|
|
| T |
33607133 |
gtgtgagtttataatggctttgccatt |
33607159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 64 - 184
Target Start/End: Complemental strand, 23080227 - 23080109
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| ||||||||||| ||||||||||||||||| ||| |||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
23080227 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccgg---atgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtga |
23080131 |
T |
 |
| Q |
164 |
g-tttataatggctttggcatt |
184 |
Q |
| |
|
| ||||||||||||||| |||| |
|
|
| T |
23080130 |
gttttataatggctttgccatt |
23080109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 32023251 - 32023369
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| ||||||||||| ||||||||||||||||| |||||||||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
32023251 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccgg---atgccatgaccggggttcgaaccccggtgcctccacttgtgtgtgtga |
32023347 |
T |
 |
| Q |
164 |
g-tttataatggctttggcatt |
184 |
Q |
| |
|
| ||||||||||||||| |||| |
|
|
| T |
32023348 |
gttttataatggctttgccatt |
32023369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 6731541 - 6731658
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| || |||||||| ||||||||||||||||| ||| |||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
6731541 |
atccagaagtcctagctcaactagcaaaatgccgaaattgttaggccgg---atgtcatgaccggggttcgaaccccggtacatccacttgtgtgtgtga |
6731637 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
6731638 |
gtttataatggctttgccatt |
6731658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 68 - 184
Target Start/End: Original strand, 24381248 - 24381361
Alignment:
| Q |
68 |
agaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagttt |
167 |
Q |
| |
|
|||||| |||||||| || ||||||||||||||||||||||| || |||||||||||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
24381248 |
agaagtcctagctcaactagcaaaatgtcgaaattgttaggctgg---atgccatgaccggggttcgaaccccggtacctccgcttgtgtgtgtgagttt |
24381344 |
T |
 |
| Q |
168 |
ataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||| |||| |
|
|
| T |
24381345 |
ataatggctttgccatt |
24381361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 61 - 184
Target Start/End: Complemental strand, 4014945 - 4014825
Alignment:
| Q |
61 |
tatatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtg |
160 |
Q |
| |
|
|||||||| |||| |||||||| ||| ||||||| ||||||||||||||||| || |||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
4014945 |
tatatccacaagtcctagctcaactgacaaaatgccgaaattgttaggccgg---atctcatgaccggggttcgaaccccggtacctccacttgtgtgtg |
4014849 |
T |
 |
| Q |
161 |
tgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||||| |||| |
|
|
| T |
4014848 |
tgagtttataatggctttgccatt |
4014825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 63 - 184
Target Start/End: Complemental strand, 38490530 - 38490411
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| |||||||| ||||||||||| ||||||||||||||||| |||||||||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
38490530 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccgg---atgccatgactggggttcgaaccccggtacctccacttgtgtgtgtg |
38490434 |
T |
 |
| Q |
163 |
ag-tttataatggctttggcatt |
184 |
Q |
| |
|
|| ||||||||| ||||| |||| |
|
|
| T |
38490433 |
agttttataatgactttgccatt |
38490411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 63 - 184
Target Start/End: Complemental strand, 727419 - 727301
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| |||||||| ||| ||||||| ||||||||||||| ||| ||||||||| |||||||||||| | |||||||||||||||||||||| |
|
|
| T |
727419 |
tatccagaagtcctagctcaactgacaaaatgccgaaattgttaggtcgg---atgccatgatcggggttcgaactccggtacctccacttgtgtgtgtg |
727323 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
727322 |
agtttataatggctttgccatt |
727301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 63 - 184
Target Start/End: Complemental strand, 23497642 - 23497524
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| |||| ||| |||| |||||| ||||||||||||||||| ||| | |||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
23497642 |
tatccagaagtcctagttcaactggtaaaatgccgaaattgttaggccgg---atgtcgtgaccggggttcgaaccccggtacctccacttgtgtgtgtg |
23497546 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
23497545 |
agtttataatggctttgtcatt |
23497524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 67 - 184
Target Start/End: Complemental strand, 34481797 - 34481683
Alignment:
| Q |
67 |
cagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtt |
166 |
Q |
| |
|
||||||| |||||||| ||||||||||| |||||||||||||| || |||||||||||||||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
34481797 |
cagaagtcctagctcaactggcaaaatgccgaaattgttaggctgg---atgccatgaccggggttcgaaccccggtaccctcacttgtgtgtgtgagtt |
34481701 |
T |
 |
| Q |
167 |
tataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||| |||| |
|
|
| T |
34481700 |
tataatggctttgccatt |
34481683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 63 - 179
Target Start/End: Complemental strand, 42007345 - 42007227
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccactt-----gtgt |
157 |
Q |
| |
|
||||||||||| |||||||| |||| |||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
42007345 |
tatccagaagtcctagctcaactggtaaaatgtcgaaattgttaggccgg---atgccatgaccggggttcgaaccccggtacctccacttgtgttgtgt |
42007249 |
T |
 |
| Q |
158 |
gtgtgagtttataatggctttg |
179 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
42007248 |
gtgtgagtttataatggctttg |
42007227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 64 - 184
Target Start/End: Complemental strand, 2287438 - 2287321
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| ||||||||||| ||||||||||||||||| || |||||||||||||||||||| |||||||||||||||||||| || |
|
|
| T |
2287438 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccgg---atatcatgaccggggttcgaaccccggtacctccacttgtgtgtggga |
2287342 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||| |||||| |||| |
|
|
| T |
2287341 |
gtttataatagctttgccatt |
2287321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 64 - 178
Target Start/End: Original strand, 3048541 - 3048652
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
||||| |||| |||||||| || |||||||||||||||||||||||||| ||||||||| |||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
3048541 |
atccataagtcctagctcaactagcaaaatgtcgaaattgttaggccgg---atgccatgatcggggttcgaaccccggtacctccacttatgtgtgtga |
3048637 |
T |
 |
| Q |
164 |
gtttataatggcttt |
178 |
Q |
| |
|
|||| |||||||||| |
|
|
| T |
3048638 |
gtttttaatggcttt |
3048652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 63 - 184
Target Start/End: Complemental strand, 41164778 - 41164660
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| |||||||| |||||||| |||||||||||||||||||| || |||||||||||||||||||| ||||||| |||| |||||||| |
|
|
| T |
41164778 |
tatccagaagtcctagctcaactggcaaagtgtcgaaattgttaggccgg---atatcatgaccggggttcgaaccccagtacctctacttatgtgtgtg |
41164682 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
41164681 |
agtttataatggctttgtcatt |
41164660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 10392644 - 10392761
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| |||| |||||| ||| ||||||||||||| ||||||||||||| |||||||||| |||| |||||||||||||||||| |
|
|
| T |
10392644 |
atccagaagtcctagctcaactggtaaaatgccgacattgttaggccgg---atgccatgaccggagttcgaaccccggtatctccacttgtgtgtgtga |
10392740 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||| ||||||||| |||| |
|
|
| T |
10392741 |
gtttattatggctttgccatt |
10392761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 84 - 184
Target Start/End: Complemental strand, 15920723 - 15920626
Alignment:
| Q |
84 |
ctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcat |
183 |
Q |
| |
|
||||||||||| ||||||||||||||||| ||| |||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||| ||| |
|
|
| T |
15920723 |
ctggcaaaatgccgaaattgttaggccgg---atgtcatgaccggggttcgaacccaggtacctccacttgtgtgtatgagtttataatggctttgccat |
15920627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 64 - 184
Target Start/End: Complemental strand, 16010742 - 16010625
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||||||||||| ||||| || | |||| |||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
16010742 |
atccagaagtcgtagctcaactggcaaaatgtcgaaattgttaagccgg---atactatgatcggggttcgaaccccggtacctcaacttgtgtgtgtga |
16010646 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
16010645 |
gtttataatggctttgtcatt |
16010625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 36794803 - 36794920
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| |||| |||||||| |||||||||||||| ||||||||| ||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
36794803 |
atccagaagtcctagctcaactggtaaaatgtcaaaattgttaggccga---atgccatgatcggggttcgaacctcggttcctccacttgtgtgtgtga |
36794899 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
36794900 |
gtttataatggctttgccatt |
36794920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 62 - 173
Target Start/End: Complemental strand, 42200993 - 42200885
Alignment:
| Q |
62 |
atatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgt |
161 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||| | ||||||||||||||| ||| ||||| ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
42200993 |
atatccagaagtcctagctcaactggcaaaatgccaaaattgttaggccgg---atgtcatgatcggggttcgaacctcggtacctccacttgtgtgtgt |
42200897 |
T |
 |
| Q |
162 |
gagtttataatg |
173 |
Q |
| |
|
|||||||||||| |
|
|
| T |
42200896 |
gagtttataatg |
42200885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 63 - 178
Target Start/End: Original strand, 43035438 - 43035550
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| |||||||| ||||||||| ||||||||||||||||| ||| ||||| |||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
43035438 |
tatccagaagtcctagctcaattggcaaaataccgaaattgttaggccgg---atgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtg |
43035534 |
T |
 |
| Q |
163 |
agtttataatggcttt |
178 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
43035535 |
agtttataatggcttt |
43035550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 67 - 184
Target Start/End: Complemental strand, 11543926 - 11543811
Alignment:
| Q |
67 |
cagaagttctagctcagctggcaaaa-tgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagt |
165 |
Q |
| |
|
||||||| |||||||| ||||||||| || ||||||||||||| ||| ||||||||| ||||||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
11543926 |
cagaagtcctagctcaactggcaaaaatgccgaaattgttaggtcgg---atgccatgatcggggtttgaaccccggtacctccacttgtgtgtgtgagt |
11543830 |
T |
 |
| Q |
166 |
ttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||| |||| |
|
|
| T |
11543829 |
ttataatggctttgccatt |
11543811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 63 - 184
Target Start/End: Complemental strand, 7975144 - 7975026
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
|||||| |||| |||||||| ||||||||||| ||||||||||||||||| |||| ||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
7975144 |
tatccacaagtcctagctcaactggcaaaatgccgaaattgttaggccgg---atgctatgaccggggttcgaaccccggtacctccacttgtgtgtgtg |
7975048 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
| |||||||| |||| |||| |
|
|
| T |
7975047 |
aaagtataatggatttgccatt |
7975026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 63 - 184
Target Start/End: Original strand, 31054046 - 31054164
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
|||||||| || |||||||| ||||||||||||||| ||||||||||||| |||||| |||||||||||||| || |||| |||| |||||||||||| |
|
|
| T |
31054046 |
tatccagaggtcctagctcaactggcaaaatgtcgatattgttaggccgg---atgccaagaccggggttcgaatccaggtatctccgcttgtgtgtgtg |
31054142 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
||||||| ||||||||| |||| |
|
|
| T |
31054143 |
agtttattatggctttgtcatt |
31054164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 63 - 172
Target Start/End: Original strand, 40592311 - 40592417
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| |||||||| ||||||||||| ||||||||||||| ||| ||||||||||||||||||||| || |||| ||||||||||| ||||| |
|
|
| T |
40592311 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggtcgg---atgccatgaccggggttcgaatcccggtatctccacttgtgcgtgtg |
40592407 |
T |
 |
| Q |
163 |
agtttataat |
172 |
Q |
| |
|
|||||||||| |
|
|
| T |
40592408 |
agtttataat |
40592417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 64 - 184
Target Start/End: Complemental strand, 8859416 - 8859299
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
||||||||||||||| ||| || |||||||||||||||||||||||||| ||| ||||| ||||||||||||| | ||||||||||||||||||| | |
|
|
| T |
8859416 |
atccagaagttctagttcaactagcaaaatgtcgaaattgttaggccgg---atgtcatgattggggttcgaaccccgatacctccacttgtgtgtgtca |
8859320 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||| ||||| |||| |
|
|
| T |
8859319 |
gtttataatgactttgtcatt |
8859299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 40812016 - 40812133
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| ||| |||| ||| ||||||| ||||||||||||| ||| ||| |||||||||||||||||||| ||||||| ||||| ||||||||| |
|
|
| T |
40812016 |
atccagaagtcctacctcaactgacaaaatgccgaaattgttaggtcgg---atgtcatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
40812112 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
40812113 |
gtttataatggctttgccatt |
40812133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 89 - 184
Target Start/End: Original strand, 42414529 - 42414621
Alignment:
| Q |
89 |
aaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||| ||||||||||||||||| |||||||||||||||||||||||| ||||| |||||||||||||||||||||||||| |||||| |||| |
|
|
| T |
42414529 |
aaaatgccgaaattgttaggccgg---atgccatgaccggggttcgaaccccggtacatccacttgtgtgtgtgagtttataatagctttgccatt |
42414621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 62 - 184
Target Start/End: Complemental strand, 11816907 - 11816788
Alignment:
| Q |
62 |
atatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgt |
161 |
Q |
| |
|
|||||||||||| |||||||| ||| |||||||||||||||||||||||| |||| || | | ||||||||||| ||||||||||||||||||||| |
|
|
| T |
11816907 |
atatccagaagtcctagctcaattggtaaaatgtcgaaattgttaggccgg---atgctattattgaggttcgaaccccggtacctccacttgtgtgtgt |
11816811 |
T |
 |
| Q |
162 |
gagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
11816810 |
aagtttataatggctttgtcatt |
11816788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 63 - 184
Target Start/End: Original strand, 15488747 - 15488865
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
|||| |||||| |||||||| || |||||| ||||||||||||||||| ||| ||||||||| ||||||||||||||||| ||||||||||||||| |
|
|
| T |
15488747 |
tatctagaagtcctagctcaactaataaaatgccgaaattgttaggccgg---atgtcatgaccggagttcgaaccctggtacccccacttgtgtgtgtg |
15488843 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||| ||||| |||| |
|
|
| T |
15488844 |
agtttataatgactttgtcatt |
15488865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 63 - 184
Target Start/End: Original strand, 23458678 - 23458796
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
|||||| |||| ||| |||| |||| |||||| ||||||||||||| || || ||||||||||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
23458678 |
tatccacaagtcctaactcaactggaaaaatgctgaaattgttaggctgg---ataccatgaccggggttcgaaccccggtacctccactcgtgtgtgtg |
23458774 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
23458775 |
agtttataatggctttgccatt |
23458796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 63 - 184
Target Start/End: Complemental strand, 28855544 - 28855426
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||| ||||| |||||||| ||||||||||| | ||||||||||| |||||||||||||| |||||||||| || ||| ||| |||||||||||||| |
|
|
| T |
28855544 |
tatccggaagtcctagctcaactggcaaaatgccaaaattgttagg---gcggatgccatgactggggttcgaatcccggttccttcacttgtgtgtgtg |
28855448 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
| ||||||||||||||| |||| |
|
|
| T |
28855447 |
aatttataatggctttgccatt |
28855426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 117 - 184
Target Start/End: Original strand, 36754997 - 36755064
Alignment:
| Q |
117 |
tgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
36754997 |
tgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataatggctttgccatt |
36755064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 96 - 184
Target Start/End: Original strand, 8532137 - 8532222
Alignment:
| Q |
96 |
cgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
8532137 |
cgaaattgttaggccgg---atgctatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataatgactttgccatt |
8532222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 89 - 184
Target Start/End: Complemental strand, 37644337 - 37644245
Alignment:
| Q |
89 |
aaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |||||||||||||| | ||||||||||||||||||| |||||||||| |||||| |||| |
|
|
| T |
37644337 |
aaaatgtcgaaattgttaggccgg---atgccatgatcggggttcgaaccccgatacctccacttgtgtgtgtaagtttataatagctttgccatt |
37644245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 58 - 184
Target Start/End: Original strand, 11061376 - 11061498
Alignment:
| Q |
58 |
atttatatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgt |
157 |
Q |
| |
|
|||||||| ||||||| ||| |||| ||| |||||||||||||||||||||||| |||| ||||||||||||||||||| || |||| ||| |||| |
|
|
| T |
11061376 |
atttatattcagaagtcctaactcaactgataaaatgtcgaaattgttaggccgg---atgc-atgaccggggttcgaaccccggcacctttactagtgt |
11061471 |
T |
 |
| Q |
158 |
gtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||||||||| |||| |
|
|
| T |
11061472 |
gtgtgagtttataatggctttgccatt |
11061498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 62 - 184
Target Start/End: Complemental strand, 31525083 - 31524964
Alignment:
| Q |
62 |
atatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgt |
161 |
Q |
| |
|
||||||| ||||||||||||| ||| ||||||| ||||||||||| |||| | |||||||||| |||||||||| | ||||||||||||||||||| |
|
|
| T |
31525083 |
atatccacaagttctagctcaactgacaaaatgccgaaattgttatgccga---aaaccatgaccggagttcgaaccccgttacctccacttgtgtgtgt |
31524987 |
T |
 |
| Q |
162 |
gagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||| ||||| |||| |
|
|
| T |
31524986 |
gagtttataatgactttgccatt |
31524964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 90 - 172
Target Start/End: Complemental strand, 36685506 - 36685427
Alignment:
| Q |
90 |
aaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataat |
172 |
Q |
| |
|
||||||||||||||||||||||| ||| ||||| |||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
36685506 |
aaatgtcgaaattgttaggccgg---atgtcatgatcggggttcgaaccctgatacctccacttgtgtgtgtgagtttataat |
36685427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 64 - 179
Target Start/End: Complemental strand, 42160386 - 42160270
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccact----tgtgtgt |
159 |
Q |
| |
|
|||||||||| |||||||| ||||||||||| |||||||||||||| |||||| ||||| |||||||||||||| |||||||||||| | ||||| |
|
|
| T |
42160386 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggc---cggatgtcatgatcggggttcgaaccccggtacctccacttatgtatgtgt |
42160290 |
T |
 |
| Q |
160 |
gtgagtttataatggctttg |
179 |
Q |
| |
|
||||||||||||||| |||| |
|
|
| T |
42160289 |
gtgagtttataatggttttg |
42160270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 63 - 184
Target Start/End: Complemental strand, 16535073 - 16534955
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| |||| ||| ||| |||||||||||||||||||||||| ||| ||||| ||| |||||||||| |||| ||||||||| ||||||| |
|
|
| T |
16535073 |
tatccagaagtcctagttcaactgataaaatgtcgaaattgttaggccgg---atgtcatgatcggagttcgaaccccggtaactccacttgggtgtgtg |
16534977 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||| |||||| |||| |
|
|
| T |
16534976 |
agtttataatagctttgtcatt |
16534955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 67 - 184
Target Start/End: Original strand, 38463141 - 38463255
Alignment:
| Q |
67 |
cagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtt |
166 |
Q |
| |
|
||||||| ||||||| ||||||||||| ||||||||||||| ||| ||| |||| |||||||||||||| | ||||||||||||||||||||| || |
|
|
| T |
38463141 |
cagaagtcttagctcaactggcaaaatgccgaaattgttaggtcgg---atgttatgatcggggttcgaaccccgatacctccacttgtgtgtgtgaatt |
38463237 |
T |
 |
| Q |
167 |
tataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||| |||| |
|
|
| T |
38463238 |
tataatggctttgccatt |
38463255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 67 - 184
Target Start/End: Original strand, 39310368 - 39310482
Alignment:
| Q |
67 |
cagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtt |
166 |
Q |
| |
|
||||||| |||||||| || ||||||| |||||||||||||||||| ||| |||| |||||||||||| | |||| ||||||||||||||||||||| |
|
|
| T |
39310368 |
cagaagtcctagctcaactagcaaaatatcgaaattgttaggccgg---atgttatgatcggggttcgaactccggtaactccacttgtgtgtgtgagtt |
39310464 |
T |
 |
| Q |
167 |
tataatggctttggcatt |
184 |
Q |
| |
|
|||||| |||||| |||| |
|
|
| T |
39310465 |
tataatagctttgtcatt |
39310482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 60 - 184
Target Start/End: Complemental strand, 12541469 - 12541348
Alignment:
| Q |
60 |
ttatatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgt |
159 |
Q |
| |
|
||||||||| |||| |||| ||| |||| ||||| ||||||||||||| ||| ||| ||||| ||||||||||||| ||||||| ||||||||||| |
|
|
| T |
12541469 |
ttatatccacaagtactaggtcaactggtaaaataccgaaattgttaggtcgg---atgtcatgatcggggttcgaacctcggtaccttcacttgtgtgt |
12541373 |
T |
 |
| Q |
160 |
gtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||||||| |||| |
|
|
| T |
12541372 |
gtgagtttataatggctttgtcatt |
12541348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 122 - 184
Target Start/End: Complemental strand, 36216827 - 36216765
Alignment:
| Q |
122 |
tgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
36216827 |
tgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataatggctttgccatt |
36216765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 79 - 179
Target Start/End: Complemental strand, 37198845 - 37198748
Alignment:
| Q |
79 |
ctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggcttt |
178 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||| | ||| ||||| |||||||||||||| ||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
37198845 |
ctcaactgacaaaatgtcgaaattgttaggccag---atggcatgatcggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggcttt |
37198749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 89 - 184
Target Start/End: Original strand, 33898255 - 33898346
Alignment:
| Q |
89 |
aaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||||||||||||||| || | ||||||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
33898255 |
aaaatgtcgaaattgttaggccgg---atgtcatgaccggggttcgaatcccg-tacctccacttgtgtgtgtgagtttataatgactttgtcatt |
33898346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 68 - 179
Target Start/End: Complemental strand, 34242576 - 34242468
Alignment:
| Q |
68 |
agaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagttt |
167 |
Q |
| |
|
|||||| |||||||| ||| |||||| ||||||||||||||||| || ||||| |||||||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
34242576 |
agaagtcctagctcaactgataaaatgccgaaattgttaggccgg---atatcatgatcggggttcgaaccccggtacctccacttgtgtgcgtgagtta |
34242480 |
T |
 |
| Q |
168 |
ataatggctttg |
179 |
Q |
| |
|
|||||||||||| |
|
|
| T |
34242479 |
ataatggctttg |
34242468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 64 - 179
Target Start/End: Original strand, 35706851 - 35706963
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||||||||||||| | |||||| |||||| |||||||||||| |||| || |||| ||||||||| |
|
|
| T |
35706851 |
atccagaagtcctagctcaactggcaaaatgtcgaaattgttag---gtcggatgtcatgactggggttcgaacctcagtacttctacttatgtgtgtga |
35706947 |
T |
 |
| Q |
164 |
gtttataatggctttg |
179 |
Q |
| |
|
|||||||||| ||||| |
|
|
| T |
35706948 |
gtttataatgactttg |
35706963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 62 - 184
Target Start/End: Original strand, 433135 - 433254
Alignment:
| Q |
62 |
atatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgt |
161 |
Q |
| |
|
|||||||||||| ||| |||| ||| |||||||||||||||||||||| || ||||| ||| | |||||||||| | | ||||||||||||||||| |
|
|
| T |
433135 |
atatccagaagtcctaactcaactgacaaaatgtcgaaattgttaggctgg---atgccgtgattgaagttcgaaccccgattcctccacttgtgtgtgt |
433231 |
T |
 |
| Q |
162 |
gagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||||| |||| |
|
|
| T |
433232 |
gagtttataatggctttgtcatt |
433254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 63 - 184
Target Start/End: Original strand, 18368792 - 18368911
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
|||| |||||| |||||||| ||||||||||| ||||||||||||| ||| || ||||| |||||||||||||| ||||||||||||||||||| || |
|
|
| T |
18368792 |
tatctagaagtcctagctcaactggcaaaatgccgaaattgttaggtcgg---atatcatgatcggggttcgaaccccggtacctccacttgtgtgtctg |
18368888 |
T |
 |
| Q |
163 |
ag-tttataatggctttggcatt |
184 |
Q |
| |
|
|| ||||||||| ||||| |||| |
|
|
| T |
18368889 |
agttttataatgactttgccatt |
18368911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 63 - 178
Target Start/End: Original strand, 5887569 - 5887678
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| ||| |||| |||| |||||||| ||||||||||||| ||| ||||||| |||||||||| ||||||||||||||| | |||||| |
|
|
| T |
5887569 |
tatccagaagtcctaactcaactggtaaaatgtc---attgttaggccgg---atgtcatgaccagggttcgaactctggtacctccacttatatgtgtg |
5887662 |
T |
 |
| Q |
163 |
agtttataatggcttt |
178 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
5887663 |
agtttataatggcttt |
5887678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 63 - 184
Target Start/End: Original strand, 18999327 - 18999445
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| ||| |||| ||||||||||| ||||||||||||| ||| ||||||| | || |||||||||| ||| |||||||||||||||||| |
|
|
| T |
18999327 |
tatccagaagtcctaactcaactggcaaaatgccgaaattgttaggtcgg---atgccattattggagttcgaaccccggttcctccacttgtgtgtgtg |
18999423 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
||||||| ||| ||||| |||| |
|
|
| T |
18999424 |
agtttattatgactttgtcatt |
18999445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 68 - 179
Target Start/End: Original strand, 32120613 - 32120718
Alignment:
| Q |
68 |
agaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagttt |
167 |
Q |
| |
|
|||||| |||||||| ||||||||||| ||||||||||||||||| || |||||| ||||||||||||||| |||||| ||||||||||| |||||| |
|
|
| T |
32120613 |
agaagtcctagctcaactggcaaaatg-cgaaattgttaggccgg---ataccatgatcggggttcgaaccct--tacctctacttgtgtgtgagagttt |
32120706 |
T |
 |
| Q |
168 |
ataatggctttg |
179 |
Q |
| |
|
|||||| ||||| |
|
|
| T |
32120707 |
ataatgactttg |
32120718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 67 - 178
Target Start/End: Complemental strand, 16368814 - 16368706
Alignment:
| Q |
67 |
cagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtt |
166 |
Q |
| |
|
||||||| |||||||| |||||||||| ||||||||||||||||| ||| ||||| ||||||| |||| | ||||||||||||| ||||| |||||| |
|
|
| T |
16368814 |
cagaagtcctagctcatctggcaaaataccgaaattgttaggccgg---atgtcatgatcggggtttgaactccggtacctccacttatgtgtatgagtt |
16368718 |
T |
 |
| Q |
167 |
tataatggcttt |
178 |
Q |
| |
|
||||||| |||| |
|
|
| T |
16368717 |
tataatgacttt |
16368706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 64 - 184
Target Start/End: Complemental strand, 7958113 - 7957998
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| |||||||||| |||||||||| |||||| |||||||||||||||||| || || ||| ||||||||||| ||||| |
|
|
| T |
7958113 |
atccagaagtcctagctcaactggcaaaataccgaaattgttgggccgg---atgccatgaccggggttcaaaacccagtatctccacttgtg--tgtga |
7958019 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||| |||||| |||| |
|
|
| T |
7958018 |
gtttataatagctttgtcatt |
7957998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #67
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 76 - 184
Target Start/End: Original strand, 4772314 - 4772419
Alignment:
| Q |
76 |
tagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggc |
175 |
Q |
| |
|
||||||| ||||||||||| ||||||||||||| |||||||||||||||||||||||| |||||||||||||||||| ||||||| |||||| |
|
|
| T |
4772314 |
tagctcaactggcaaaatgctgaaattgttaggc---cggatgccatgaccggggttcgaatttcggtacctccacttgtgtgatagagtttacaatggc |
4772410 |
T |
 |
| Q |
176 |
tttggcatt |
184 |
Q |
| |
|
|||| |||| |
|
|
| T |
4772411 |
tttgccatt |
4772419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #68
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 88 - 184
Target Start/End: Original strand, 10202193 - 10202286
Alignment:
| Q |
88 |
caaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||||||||||| |||| |||| |||||||||||| |||||||||||| | ||||||||||||||||||||||| |||| |
|
|
| T |
10202193 |
caaaatgtcgaaattgttaggccgg---atgctatgatcggggttcgaacttcagtacctccacttatatgtgtgagtttataatggctttgtcatt |
10202286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #69
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 63 - 184
Target Start/End: Complemental strand, 19134647 - 19134530
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaa-tgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgt |
161 |
Q |
| |
|
|||||| |||| |||||||| |||| |||| |||||||||||||||||| | ||||| ||||||| |||||||||| | |||||||||||||| ||| |
|
|
| T |
19134647 |
tatccataagtcctagctcaactggaaaaaatgtcgaaattgttaggccag---atgccgtgaccggagttcgaaccccgatacctccacttgtg--tgt |
19134553 |
T |
 |
| Q |
162 |
gagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||| |||||| |||| |
|
|
| T |
19134552 |
gagtttataatcgctttgtcatt |
19134530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #70
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 61 - 184
Target Start/End: Complemental strand, 21840580 - 21840461
Alignment:
| Q |
61 |
tatatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtg |
160 |
Q |
| |
|
||||||||||||| |||||||| ||| |||| |||||||||||||| | || || ||||| ||||||||||| || | |||||||||||||||| | |
|
|
| T |
21840580 |
tatatccagaagtcctagctcaactgacaaa-tgtcgaaattgttaagttgg---atatcatgatcggggttcgaatcccgatacctccacttgtgtggg |
21840485 |
T |
 |
| Q |
161 |
tgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||||| |||| |
|
|
| T |
21840484 |
tgagtttataatggctttgccatt |
21840461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #71
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 130 - 179
Target Start/End: Original strand, 23840879 - 23840928
Alignment:
| Q |
130 |
gttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttg |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
23840879 |
gttcgaaccctggtacctccacttgtgtgtgtgagtttataatgactttg |
23840928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #72
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 89 - 172
Target Start/End: Complemental strand, 30854839 - 30854759
Alignment:
| Q |
89 |
aaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataat |
172 |
Q |
| |
|
|||||||||||||||||||| || ||| ||||||||||| |||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
30854839 |
aaaatgtcgaaattgttaggacga---atgtcatgaccggggctcgaaccccggtaccttcacttgtgtgtgtgagtttataat |
30854759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #73
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 63 - 184
Target Start/End: Original strand, 18055856 - 18055975
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaa-tgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgt |
161 |
Q |
| |
|
|||||| |||| |||||||| |||||||| |||| |||||| |||||||| ||| ||||| ||||||||||||| | |||||||| |||||||||| |
|
|
| T |
18055856 |
tatccataagtcctagctcaattggcaaaaatgtcaaaattgctaggccgg---atgtcatgatcggggttcgaaccgcgttacctccatttgtgtgtgt |
18055952 |
T |
 |
| Q |
162 |
gagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||| ||||| |||| |
|
|
| T |
18055953 |
gagtttataatgactttgtcatt |
18055975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #74
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 70 - 184
Target Start/End: Original strand, 31819643 - 31819754
Alignment:
| Q |
70 |
aagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttat |
169 |
Q |
| |
|
|||| ||| |||| ||||||||||||||||||| ||||||||| ||| |||||||| ||||| |||| ||||||||||| ||||||||||||||| |
|
|
| T |
31819643 |
aagtcctaactcaactggcaaaatgtcgaaattattaggccgg---atggcatgaccgaagttcgtttcctgatacctccacttatgtgtgtgagtttat |
31819739 |
T |
 |
| Q |
170 |
aatggctttggcatt |
184 |
Q |
| |
|
||| |||||| |||| |
|
|
| T |
31819740 |
aatagctttgtcatt |
31819754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #75
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 78 - 168
Target Start/End: Original strand, 41196976 - 41197063
Alignment:
| Q |
78 |
gctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagttta |
168 |
Q |
| |
|
||||| ||||||||||| ||||||||||| ||||| |||||||||||||||||||||||| | ||| |||| || |||||||||||||| |
|
|
| T |
41196976 |
gctcaactggcaaaatgccgaaattgttaagccgg---atgccatgaccggggttcgaaccccgatacttccatttatgtgtgtgagttta |
41197063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #76
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 67 - 184
Target Start/End: Complemental strand, 42133568 - 42133453
Alignment:
| Q |
67 |
cagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgag-t |
165 |
Q |
| |
|
||||||| ||| ||| ||||||||||| ||||||||||||| ||| |||||||||| ||||||||| || | ||||||||||||||| |||||| | |
|
|
| T |
42133568 |
cagaagtcttagttcaactggcaaaatgccgaaattgttaggtcgg---atgccatgactagggttcgaatcccgatacctccacttgtgtttgtgagtt |
42133472 |
T |
 |
| Q |
166 |
ttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||| |||| |
|
|
| T |
42133471 |
ttataatggctttgccatt |
42133453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #77
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 68 - 184
Target Start/End: Original strand, 18779914 - 18780028
Alignment:
| Q |
68 |
agaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgag-tt |
166 |
Q |
| |
|
|||||| |||| ||| ||| |||||||||||||||||||| ||| ||||||||||| || |||||||| ||||||||||||| |||||||||| || |
|
|
| T |
18779914 |
agaagtcctagttcaattggtaaaatgtcgaaattgttaggtcgg---atgccatgaccaggcttcgaaccacggtacctccacttatgtgtgtgagttt |
18780010 |
T |
 |
| Q |
167 |
tataatggctttggcatt |
184 |
Q |
| |
|
||||||| ||||| |||| |
|
|
| T |
18780011 |
tataatgactttgccatt |
18780028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #78
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 39218680 - 39218798
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| | | |||||| ||||||||||||| ||| ||| |||| |||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
39218680 |
atccagaagtcctagctcaattcgaaaaatgccgaaattgttaggtcgg---atgttatgatcggggttcgaaccccggtacctccacttgtatgtgtga |
39218776 |
T |
 |
| Q |
164 |
g-tttataatggctttggcatt |
184 |
Q |
| |
|
| ||||||||| ||||| |||| |
|
|
| T |
39218777 |
gttttataatgactttgtcatt |
39218798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #79
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 63 - 184
Target Start/End: Complemental strand, 12847085 - 12846965
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtg--tg |
160 |
Q |
| |
|
||||||||||||||| |||| |||| ||||| | |||||||||||| || ||| ||||| | |||||||||||||||||||||| |||||||| || |
|
|
| T |
12847085 |
tatccagaagttctaactcaactggtaaaataccaaaattgttaggctgg---atgtcatgatcagggttcgaaccctggtacctcctcttgtgtgtgtg |
12846989 |
T |
 |
| Q |
161 |
tgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||| |||| |||| |||| |
|
|
| T |
12846988 |
tgagtttatcatggttttgccatt |
12846965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #80
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 96 - 184
Target Start/End: Original strand, 35493692 - 35493777
Alignment:
| Q |
96 |
cgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||| ||| | ||| || ||||||||| | ||||||||||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
35493692 |
cgaaattgttaggccgg---atgtcgtgatcgaggttcgaactccggtacctccacttgtgtgtgtgaatttataatggctttgtcatt |
35493777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #81
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 64 - 184
Target Start/End: Complemental strand, 35687915 - 35687799
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| ||| |||||| |||||||||||||| |||||||||||| |||| ||||||| | |||| |||||||| ||||| | | |
|
|
| T |
35687915 |
atccagaagtcctagctcaactgataaaatgccgaaattgttaggc---cggatgccatgatcgggattcgaactccggta-ctccacttatgtgtataa |
35687820 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||| ||||| |||| |
|
|
| T |
35687819 |
gtttataatgactttgtcatt |
35687799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #82
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 114 - 184
Target Start/End: Original strand, 44276309 - 44276379
Alignment:
| Q |
114 |
ggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||| ||||| ||||||||||||| ||| |||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
44276309 |
ggatgtcatgattggggttcgaaccccggtttctccacttgtgtgtgtgagtttataatggctttgccatt |
44276379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #83
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 89 - 179
Target Start/End: Complemental strand, 32517922 - 32517834
Alignment:
| Q |
89 |
aaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccac-ttgtgtgtgtgagtttataatggctttg |
179 |
Q |
| |
|
||||||||||||||||||||| || | | |||||||| ||||||||||| ||||||||||| |||||||||||||||||| ||| ||||| |
|
|
| T |
32517922 |
aaaatgtcgaaattgttaggctgg---acgtcatgaccgaggttcgaaccccggtacctccactttgtgtgtgtgagtttatgatgactttg |
32517834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #84
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 116 - 160
Target Start/End: Original strand, 18251422 - 18251466
Alignment:
| Q |
116 |
atgccatgaccggggttcgaaccctggtacctccacttgtgtgtg |
160 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
18251422 |
atgccatgatcggggttcgaaccctggtacctccacttgtgtgtg |
18251466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #85
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 70 - 164
Target Start/End: Original strand, 38140696 - 38140787
Alignment:
| Q |
70 |
aagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgag |
164 |
Q |
| |
|
|||| ||| |||| |||| |||||| ||||||||||| ||||| ||| ||||| |||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
38140696 |
aagtcctaactcaactggtaaaatgccgaaattgttaagccgg---atgtcatgatcggggttcgaaccccggtacctccatttgtgtgtgtgag |
38140787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #86
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 97 - 174
Target Start/End: Original strand, 6590915 - 6590989
Alignment:
| Q |
97 |
gaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatgg |
174 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||| || || ||||||||||||| |||||||||||||||||||| |
|
|
| T |
6590915 |
gaaattgttaggccgg---atgttatgaccggggttcaaatcccggtacctccacttatgtgtgtgagtttataatgg |
6590989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #87
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 63 - 172
Target Start/End: Original strand, 42211276 - 42211382
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| ||| ||| |||| ||||||||||||||||||||| || |||| ||||||||| ||||||||| | |||||||| || ||| |||| |
|
|
| T |
42211276 |
tatccagaagtcttagttcaactggtaaaatgtcgaaattgttaggc---cgcatgctatgaccgggattcgaaccccgatacctccatttatgtatgtg |
42211372 |
T |
 |
| Q |
163 |
agtttataat |
172 |
Q |
| |
|
||||| |||| |
|
|
| T |
42211373 |
agtttttaat |
42211382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #88
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 70 - 178
Target Start/End: Complemental strand, 7315884 - 7315779
Alignment:
| Q |
70 |
aagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttat |
169 |
Q |
| |
|
|||| |||||||| || ||||||| ||||||||||| |||| || |||||| ||||||||||| | ||||||||||||| ||||||||||||||| |
|
|
| T |
7315884 |
aagtcctagctcaactaacaaaatgctgaaattgttagaccgg---ataccatgattggggttcgaactccggtacctccacttatgtgtgtgagtttat |
7315788 |
T |
 |
| Q |
170 |
aatggcttt |
178 |
Q |
| |
|
||| ||||| |
|
|
| T |
7315787 |
aatagcttt |
7315779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #89
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 142 - 184
Target Start/End: Original strand, 44887188 - 44887230
Alignment:
| Q |
142 |
gtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
44887188 |
gtacctccacttgtgtgtgtgagtttataatggctttgccatt |
44887230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #90
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 75 - 172
Target Start/End: Complemental strand, 12221263 - 12221170
Alignment:
| Q |
75 |
ctagctcagctggcaaaa-tgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataat |
172 |
Q |
| |
|
|||||||| ||||||||| || |||||||||||||||| | ||||||||| |||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
12221263 |
ctagctcaactggcaaaaatgatgaaattgttaggccgg---acgccatgaccagggttcgaaccccagtacctccacttgtg--tgtgagtttataat |
12221170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #91
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 62 - 173
Target Start/End: Complemental strand, 31516336 - 31516228
Alignment:
| Q |
62 |
atatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgt |
161 |
Q |
| |
|
||||||| |||| ||| |||| |||| |||||| ||||||||||||||||| | |||||| | ||||||||||| ||||| ||||||| ||||||| |
|
|
| T |
31516336 |
atatccacaagtcctaactcaactggaaaaatgccgaaattgttaggccgg---aaaccatgatcagggttcgaacctcggtacatccacttttgtgtgt |
31516240 |
T |
 |
| Q |
162 |
gagtttataatg |
173 |
Q |
| |
|
| |||||||||| |
|
|
| T |
31516239 |
gtgtttataatg |
31516228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #92
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 114 - 174
Target Start/End: Original strand, 11012021 - 11012081
Alignment:
| Q |
114 |
ggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatgg |
174 |
Q |
| |
|
||||||||||| ||| |||||||||| |||| ||||||||| |||||||||||||||||| |
|
|
| T |
11012021 |
ggatgccatgatcggagttcgaaccccagtacttccacttgtatgtgtgagtttataatgg |
11012081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #93
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 120 - 179
Target Start/End: Complemental strand, 40710911 - 40710851
Alignment:
| Q |
120 |
catgaccggggttcgaaccctggtacctccac-ttgtgtgtgtgagtttataatggctttg |
179 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| |||||| |||| |||||| ||||||||| |
|
|
| T |
40710911 |
catgaccggggttcgaaccccggtacctccactttgtgtttgtgtgtttatgatggctttg |
40710851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #94
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 113 - 184
Target Start/End: Complemental strand, 8293638 - 8293567
Alignment:
| Q |
113 |
cggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||| |||| || |||||||| || | ||||||||||| ||||||||| ||||||||||||||| |||| |
|
|
| T |
8293638 |
cggatgctatgatcgaggttcgaatcccgatacctccacttatgtgtgtgaatttataatggctttgtcatt |
8293567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #95
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 142 - 176
Target Start/End: Complemental strand, 2476999 - 2476965
Alignment:
| Q |
142 |
gtacctccacttgtgtgtgtgagtttataatggct |
176 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
2476999 |
gtacctccacttgtgtgtgtgagtttataatggct |
2476965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #96
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 114 - 172
Target Start/End: Original strand, 17882760 - 17882818
Alignment:
| Q |
114 |
ggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataat |
172 |
Q |
| |
|
|||||||||||| |||||||||||| ||| |||||||| |||||||||||||||||| |
|
|
| T |
17882760 |
ggatgccatgactagggttcgaaccccggtgtctccacttttgtgtgtgagtttataat |
17882818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #97
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 64 - 184
Target Start/End: Complemental strand, 29741087 - 29740970
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| |||| |||||||||||||| ||||| || || ||| | |||||||||| || ||||||| ||||| ||||||||| |
|
|
| T |
29741087 |
atccagaagtcctagctcaactggaaaaatgtcgaaattattaggttgg---atatcataattggggttcgaatcccggtaccttcacttatgtgtgtga |
29740991 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
||||| |||| ||||| |||| |
|
|
| T |
29740990 |
gtttacaatgactttgtcatt |
29740970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #98
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 121 - 184
Target Start/End: Original strand, 43696466 - 43696533
Alignment:
| Q |
121 |
atgaccggggttcgaaccctggtacctccact----tgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||||||||||| |||||||||| |||| |||| |
|
|
| T |
43696466 |
atgaccggggttcgaaccccggtacctccacttatgtgtgtgtgtgaatttataatggttttgccatt |
43696533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #99
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 43841788 - 43841730
Alignment:
| Q |
120 |
catgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggcttt |
178 |
Q |
| |
|
||||| ||| |||||||| | | ||||||||||||||||||||||||||||||| |||| |
|
|
| T |
43841788 |
catgatcggagttcgaactccgatacctccacttgtgtgtgtgagtttataatgacttt |
43841730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #100
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 77 - 184
Target Start/End: Complemental strand, 11091702 - 11091598
Alignment:
| Q |
77 |
agctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggct |
176 |
Q |
| |
|
|||||| || |||||||| ||||||||||||| | | ||| ||||| |||| |||||| |||| ||| || |||||| |||||||||||||||| ||| |
|
|
| T |
11091702 |
agctcaactagcaaaatgccgaaattgttaggtcag---atgtcatgatcgggattcgaatcctgatacatctacttgtatgtgtgagtttataatagct |
11091606 |
T |
 |
| Q |
177 |
ttggcatt |
184 |
Q |
| |
|
||| |||| |
|
|
| T |
11091605 |
ttgccatt |
11091598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #101
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 143 - 184
Target Start/End: Original strand, 19593598 - 19593639
Alignment:
| Q |
143 |
tacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
19593598 |
tacctccacttatgtgtgtgagtttataatggctttgccatt |
19593639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #102
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 120 - 179
Target Start/End: Original strand, 17052609 - 17052669
Alignment:
| Q |
120 |
catgaccggggttcgaaccctggtacctccac-ttgtgtgtgtgagtttataatggctttg |
179 |
Q |
| |
|
|||||||||||||| ||| | ||||||||||| |||||||||||| ||||| ||||||||| |
|
|
| T |
17052609 |
catgaccggggttcaaactccggtacctccactttgtgtgtgtgaatttatgatggctttg |
17052669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #103
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 120 - 179
Target Start/End: Original strand, 22999127 - 22999187
Alignment:
| Q |
120 |
catgaccggggttcgaaccctggtacctccac-ttgtgtgtgtgagtttataatggctttg |
179 |
Q |
| |
|
|||||||||||||||||||| | |||||||| |||||||||||||||||| |||| |||| |
|
|
| T |
22999127 |
catgaccggggttcgaaccccgacacctccactttgtgtgtgtgagtttatgatggttttg |
22999187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #104
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 113 - 160
Target Start/End: Original strand, 12400689 - 12400736
Alignment:
| Q |
113 |
cggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtg |
160 |
Q |
| |
|
|||||||||||| ||||||||||| |||| ||||| |||||||||||| |
|
|
| T |
12400689 |
cggatgccatgatcggggttcgaatcctgataccttcacttgtgtgtg |
12400736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #105
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 141 - 179
Target Start/End: Original strand, 6738824 - 6738862
Alignment:
| Q |
141 |
ggtacctccacttgtgtgtgtgagtttataatggctttg |
179 |
Q |
| |
|
||||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
6738824 |
ggtacctccacttatgtgtgggagtttataatggctttg |
6738862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #106
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 146 - 184
Target Start/End: Original strand, 16179485 - 16179523
Alignment:
| Q |
146 |
ctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |||| |
|
|
| T |
16179485 |
ctccacttgtgtgtgtgagtttataatagctttgccatt |
16179523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #107
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 65 - 111
Target Start/End: Complemental strand, 18469560 - 18469514
Alignment:
| Q |
65 |
tccagaagttctagctcagctggcaaaatgtcgaaattgttaggccg |
111 |
Q |
| |
|
|||| |||| |||||||| ||||| |||||||||||||||||||||| |
|
|
| T |
18469560 |
tccataagtcctagctcaactggctaaatgtcgaaattgttaggccg |
18469514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #108
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 73 - 173
Target Start/End: Original strand, 41520506 - 41520603
Alignment:
| Q |
73 |
ttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataat |
172 |
Q |
| |
|
|||||||||| |||| |||||| |||||||||||| | | ||| ||||| ||||||| ||| || | |||||||| |||||||| |||||||||||| |
|
|
| T |
41520506 |
ttctagctcaactggtaaaatgctgaaattgttaggtcag---atgtcatgatcggggtttgaatcccgatacctccatttgtgtgtatgagtttataat |
41520602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #109
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 64 - 178
Target Start/End: Complemental strand, 4695121 - 4695012
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||| | |||||| | |||||||||||||||||||||| | | |||||| ||||| | |||||||||||| || ||||| | ||||| ||| |
|
|
| T |
4695121 |
atccagaaatcctagcttaactggcaaaatgtcgaaattgtt---cggtcggatgtcatgatcagggttcgaaccccagtgtctcca--tttgtgtttga |
4695027 |
T |
 |
| Q |
164 |
gtttataatggcttt |
178 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
4695026 |
gtttataatggcttt |
4695012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #110
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 87 - 178
Target Start/End: Original strand, 12448908 - 12448996
Alignment:
| Q |
87 |
gcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggcttt |
178 |
Q |
| |
|
||||||| |||||||||||||| ||| || ||||| ||| ||||||| || ||||||| ||||||| |||||||||||||||| |||| |
|
|
| T |
12448908 |
gcaaaatatcgaaattgttaggtcgg---atatcatgatcggcgttcgaattctagtacctcaacttgtgagtgtgagtttataatgacttt |
12448996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #111
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 143 - 184
Target Start/End: Original strand, 19967809 - 19967850
Alignment:
| Q |
143 |
tacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||| |||||||||||||||||| ||||| |||| |
|
|
| T |
19967809 |
tacctccacttgcgtgtgtgagtttataatgactttgtcatt |
19967850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #112
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 120 - 179
Target Start/End: Original strand, 816398 - 816458
Alignment:
| Q |
120 |
catgaccggggttcgaaccctggtacctccactt-gtgtgtgtgagtttataatggctttg |
179 |
Q |
| |
|
||||||| ||||||||||| ||||| ||||||| |||||||||||||||| |||| |||| |
|
|
| T |
816398 |
catgaccatggttcgaaccccggtacatccactttgtgtgtgtgagtttatgatggttttg |
816458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #113
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 120 - 179
Target Start/End: Original strand, 13491078 - 13491138
Alignment:
| Q |
120 |
catgaccggggttcgaaccctggtacctccactt-gtgtgtgtgagtttataatggctttg |
179 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||||||||||||||| |||||||| |
|
|
| T |
13491078 |
catgaccggggttcgaacctcaatacctccactttgtgtgtgtgagtttatggtggctttg |
13491138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #114
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 89 - 178
Target Start/End: Complemental strand, 25219740 - 25219654
Alignment:
| Q |
89 |
aaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttg-tgtgtgtgagtttataatggcttt |
178 |
Q |
| |
|
|||||||||||||||||||||||| | | |||||| ||| ||||||| | ||||||||||||| | |||||||||||||||| ||||| |
|
|
| T |
25219740 |
aaaatgtcgaaattgttaggccgg---acgtcatgac-gggattcgaactcaggtacctccactttatatgtgtgagtttataatagcttt |
25219654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #115
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 144 - 184
Target Start/End: Complemental strand, 32738356 - 32738316
Alignment:
| Q |
144 |
acctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||| |||||||||||||||||||||||||| |||| |||| |
|
|
| T |
32738356 |
accttcacttgtgtgtgtgagtttataatggttttgccatt |
32738316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #116
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 127 - 178
Target Start/End: Complemental strand, 38082975 - 38082926
Alignment:
| Q |
127 |
ggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggcttt |
178 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||||||||||||| |||| |
|
|
| T |
38082975 |
ggggttcgaaccctagtacctccac--atgtgtgtgagtttataatgacttt |
38082926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0402 (Bit Score: 89; Significance: 7e-43; HSPs: 1)
Name: scaffold0402
Description:
Target: scaffold0402; HSP #1
Raw Score: 89; E-Value: 7e-43
Query Start/End: Original strand, 62 - 184
Target Start/End: Complemental strand, 1372 - 1253
Alignment:
| Q |
62 |
atatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgt |
161 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||| ||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
1372 |
atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccgg---atgccatgaccggggttcgaaccccggtacctccacttgtgtgtgt |
1276 |
T |
 |
| Q |
162 |
gagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||||| |||| |
|
|
| T |
1275 |
gagtttataatggctttgccatt |
1253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 89; Significance: 7e-43; HSPs: 145)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 89; E-Value: 7e-43
Query Start/End: Original strand, 62 - 184
Target Start/End: Original strand, 8381076 - 8381195
Alignment:
| Q |
62 |
atatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgt |
161 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||| ||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
8381076 |
atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccgg---atgccatgaccggggttcgaaccccggtacctccacttgtgtgtgt |
8381172 |
T |
 |
| Q |
162 |
gagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||||| |||| |
|
|
| T |
8381173 |
gagtttataatggctttgccatt |
8381195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 63 - 184
Target Start/End: Original strand, 13525167 - 13525285
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| |||||||| ||||||||||| ||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
13525167 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccgg---atgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtg |
13525263 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
13525264 |
agtttataatggctttgccatt |
13525285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 64 - 184
Target Start/End: Complemental strand, 4232306 - 4232189
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| ||||||||||| ||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4232306 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccgg---atgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtga |
4232210 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
4232209 |
gtttataatggctttgccatt |
4232189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 64 - 184
Target Start/End: Complemental strand, 47410881 - 47410764
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||||||||||| ||| ||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47410881 |
atccagaagtcctagctcaactggcaaaatgtcgaaattgttaggtcgg---atgtcatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
47410785 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
47410784 |
gtttataatggctttgccatt |
47410764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 3917765 - 3917882
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| ||||||||||| ||||||||||||||||| ||| |||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3917765 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccgg---atgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtga |
3917861 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
3917862 |
gtttataatggctttgccatt |
3917882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 64 - 184
Target Start/End: Complemental strand, 32961107 - 32960990
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| ||||||||||| ||||||||||||||| | |||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
32961107 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccag---atgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtga |
32961011 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
32961010 |
gtttataatggctttgccatt |
32960990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 64 - 184
Target Start/End: Complemental strand, 38127971 - 38127854
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||||||||||||||| |||| ||||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
38127971 |
atccagaagtcctagctcaactggcaaaatgtcgaaattgttaggccgg---atgctatgaccggggttcgaaccccggttcctccacttgtgtgtgtga |
38127875 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
38127874 |
gtttataatggctttgccatt |
38127854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 64 - 179
Target Start/End: Complemental strand, 4833238 - 4833126
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| ||||||||||| ||||||||||||||||| |||||||||||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
4833238 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccgg---atgccatgaccggggttcgaaccccggtaccttcacttgtgtgtgtga |
4833142 |
T |
 |
| Q |
164 |
gtttataatggctttg |
179 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
4833141 |
gtttataatggctttg |
4833126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 63 - 184
Target Start/End: Complemental strand, 4976838 - 4976720
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| |||||||| ||||||||||| | ||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
4976838 |
tatccagaagtcctagctcaactggcaaaatgccaaaattgttaggccgg---atgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtt |
4976742 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
4976741 |
agtttataatggctttgccatt |
4976720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 70 - 184
Target Start/End: Complemental strand, 10474037 - 10473926
Alignment:
| Q |
70 |
aagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttat |
169 |
Q |
| |
|
|||| |||||||| ||||||||||| |||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
10474037 |
aagtcctagctcaactggcaaaatgctgaaattgttaggccgg---atgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttat |
10473941 |
T |
 |
| Q |
170 |
aatggctttggcatt |
184 |
Q |
| |
|
|||||||||| |||| |
|
|
| T |
10473940 |
aatggctttgccatt |
10473926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 63 - 184
Target Start/End: Complemental strand, 24650677 - 24650558
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| ||| |||| ||||||||||| ||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
24650677 |
tatccagaagtcctacctcaactggcaaaatgccgaaattgttaggccgg---atgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtg |
24650581 |
T |
 |
| Q |
163 |
ag-tttataatggctttggcatt |
184 |
Q |
| |
|
|| ||||||||||||||| |||| |
|
|
| T |
24650580 |
agttttataatggctttgccatt |
24650558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 62 - 184
Target Start/End: Original strand, 32590969 - 32591088
Alignment:
| Q |
62 |
atatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgt |
161 |
Q |
| |
|
|||||||||||| |||||||| |||| |||||||||||||||||||||||| ||||||||| ||||||||||| || ||||||||||||||||||||| |
|
|
| T |
32590969 |
atatccagaagtcctagctcaactggtaaaatgtcgaaattgttaggccgg---atgccatgatcggggttcgaatcccggtacctccacttgtgtgtgt |
32591065 |
T |
 |
| Q |
162 |
gagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
32591066 |
cagtttataatggctttgccatt |
32591088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 55 - 184
Target Start/End: Original strand, 47068996 - 47069123
Alignment:
| Q |
55 |
ttaatttatatccagaagttctagctcagctggcaaaa-tgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccactt |
153 |
Q |
| |
|
||||||| ||||||||||| ||||||| ||||||||| || ||||||||||||||||| |||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
47068996 |
ttaatttctatccagaagtcttagctcaactggcaaaaatgccgaaattgttaggccgg---atgccatgaccggggttcgaaccccggtacctccactt |
47069092 |
T |
 |
| Q |
154 |
gtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||||||| |||| |||| |
|
|
| T |
47069093 |
gtgtgtgtgagtttataatggttttgccatt |
47069123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 11029662 - 11029780
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaa-tgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
|||||||||| |||||||| ||||||||| ||||||||||||||||| || ||||||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
11029662 |
atccagaagtcctagctcaactggcaaaaatgtcgaaattgttaggctgg---atgccatgaccagggttcgaaccccggtacctccacttgtgtgtgtg |
11029758 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
11029759 |
agtttataatggctttgccatt |
11029780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 62 - 184
Target Start/End: Complemental strand, 29212196 - 29212075
Alignment:
| Q |
62 |
atatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtg--t |
159 |
Q |
| |
|
||||||| |||| |||||||| ||||||||||| ||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||| | |
|
|
| T |
29212196 |
atatccataagtcctagctcaactggcaaaatgccgaaattgttaggccgg---atgccatgaccggggttcgaaccccggtacctccacttgtgtgtgt |
29212100 |
T |
 |
| Q |
160 |
gtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||||||| |||| |
|
|
| T |
29212099 |
gtgagtttataatggctttgccatt |
29212075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 68 - 184
Target Start/End: Original strand, 1242220 - 1242333
Alignment:
| Q |
68 |
agaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagttt |
167 |
Q |
| |
|
|||||| |||||||| ||||||||||| ||||||| ||||||||| ||||||||| |||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
1242220 |
agaagtcctagctcaactggcaaaatgccgaaattattaggccgg---atgccatgatcggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
1242316 |
T |
 |
| Q |
168 |
ataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||| |||| |
|
|
| T |
1242317 |
ataatggctttgccatt |
1242333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 27396853 - 27396969
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| ||| ||||||| ||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
27396853 |
atccagaagtcctagctcaactgacaaaatgccgaaattgttaggccgg---atgccatgaccggggttcgaaccc-ggtacctccacttgtgtgtgtga |
27396948 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||| ||||| |||| |
|
|
| T |
27396949 |
gtttataatgactttgccatt |
27396969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 61 - 184
Target Start/End: Original strand, 34397676 - 34397796
Alignment:
| Q |
61 |
tatatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtg |
160 |
Q |
| |
|
||||||||||||| |||| ||| ||||||||||| ||||||||||||||||| ||| ||| |||||||||||||||| | |||||||||||||||||| |
|
|
| T |
34397676 |
tatatccagaagtcctagttcaactggcaaaatgccgaaattgttaggccgg---atgtcataaccggggttcgaaccccgatacctccacttgtgtgtg |
34397772 |
T |
 |
| Q |
161 |
tgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||||| |||| |
|
|
| T |
34397773 |
tgagtttataatggctttgccatt |
34397796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 63 - 184
Target Start/End: Complemental strand, 28171110 - 28170991
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaa-tgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgt |
161 |
Q |
| |
|
||||||||||| |||||||| ||||||||| || ||||||||||||||||| |||||||||||||||||||||||| || ||||| |||||||||||| |
|
|
| T |
28171110 |
tatccagaagtcctagctcaactggcaaaaatgccgaaattgttaggccgg---atgccatgaccggggttcgaaccccggcacctctacttgtgtgtgt |
28171014 |
T |
 |
| Q |
162 |
gagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||||| |||| |
|
|
| T |
28171013 |
gagtttataatggctttgccatt |
28170991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 63 - 177
Target Start/End: Complemental strand, 30553098 - 30552987
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| |||||||| ||||||||||| |||||||||||| |||| ||||||||||||| |||||||||| | |||||||||||||||||||| |
|
|
| T |
30553098 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttagaccgg---atgccatgaccggagttcgaaccccgatacctccacttgtgtgtgtg |
30553002 |
T |
 |
| Q |
163 |
agtttataatggctt |
177 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
30553001 |
agtttataatggctt |
30552987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 76 - 184
Target Start/End: Original strand, 3440736 - 3440842
Alignment:
| Q |
76 |
tagctcagctggcaaaa-tgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatgg |
174 |
Q |
| |
|
||||||| ||||||||| || ||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
3440736 |
tagctcaactggcaaaaatgccgaaattgttaggccgg---atgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataatgg |
3440832 |
T |
 |
| Q |
175 |
ctttggcatt |
184 |
Q |
| |
|
||||| |||| |
|
|
| T |
3440833 |
ctttgccatt |
3440842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 63 - 184
Target Start/End: Original strand, 10047870 - 10047988
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| |||||||| ||| |||||| ||||||||||| ||||| |||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
10047870 |
tatccagaagtcctagctcaattggtaaaatgccgaaattgttatgccgg---atgccatgaccggggttcgaactctggtaccttcacttgtgtgtgtg |
10047966 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
10047967 |
agtttataatggctttgccatt |
10047988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 63 - 184
Target Start/End: Complemental strand, 24910418 - 24910300
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| |||||||| ||||||||||| |||||||||||||| || || ||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
24910418 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggctgg---atatcatgatcggggttcgaaccccggtacctccacttgtgtgtgtg |
24910322 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
24910321 |
agtttataatggctttgccatt |
24910300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 64 - 184
Target Start/End: Complemental strand, 43605705 - 43605587
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| ||||||||||| ||| |||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
43605705 |
atccagaagtcctagctcaactggcaaaatgctgaatttgttaggccgg---atgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtga |
43605609 |
T |
 |
| Q |
164 |
g-tttataatggctttggcatt |
184 |
Q |
| |
|
| ||||||||||||||| |||| |
|
|
| T |
43605608 |
gttttataatggctttgccatt |
43605587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 63 - 184
Target Start/End: Original strand, 44107379 - 44107496
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
|||||| ||||||||||||| |||||||||||| ||||||||||||| |||||||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
44107379 |
tatccacaagttctagctcaactggcaaaatgttgaaattgttaggc---cggatgccatgaccgggg-tcgaacctcggtacctccacttgtgtgtgtg |
44107474 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||| |||||| |||| |
|
|
| T |
44107475 |
agtttataatagctttgtcatt |
44107496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 68 - 184
Target Start/End: Complemental strand, 52256878 - 52256764
Alignment:
| Q |
68 |
agaagttctagctcagctggcaaaa-tgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtt |
166 |
Q |
| |
|
||||||||||||||| ||||||||| |||||| |||||||||| || |||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
52256878 |
agaagttctagctcaactggcaaaaatgtcgatattgttaggctgg---atgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtt |
52256782 |
T |
 |
| Q |
167 |
tataatggctttggcatt |
184 |
Q |
| |
|
||||||| ||||| |||| |
|
|
| T |
52256781 |
tataatgactttgccatt |
52256764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 24751752 - 24751869
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
||||| |||| |||||||| ||||||||||| ||||||||||||||||| ||| ||||| |||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
24751752 |
atccacaagtcctagctcaactggcaaaatgccgaaattgttaggccgg---atgtcatgatcggggttcgaaccctggtaccttcacttgtgtgtgtga |
24751848 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||| |||| |
|
|
| T |
24751849 |
atttataatggctttgtcatt |
24751869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 63 - 184
Target Start/End: Original strand, 41464662 - 41464782
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccact--tgtgtgtg |
160 |
Q |
| |
|
||||||||||| |||||||| ||||||||||| ||||||||||||| ||| |||||||||||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
41464662 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggtcgg---atgccatgaccggggttcgaaccccagtacctccacttgtgtgtgtg |
41464758 |
T |
 |
| Q |
161 |
tgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||||| |||| |
|
|
| T |
41464759 |
tgagtttataatggctttgccatt |
41464782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 62 - 178
Target Start/End: Complemental strand, 46838858 - 46838745
Alignment:
| Q |
62 |
atatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgt |
161 |
Q |
| |
|
|||||||||||| |||||||| |||| |||||| ||||||||||||||||| ||||||||||||||| |||||| | ||||||| ||||||||||||| |
|
|
| T |
46838858 |
atatccagaagtcctagctcaactggaaaaatgccgaaattgttaggccgg---atgccatgaccggggctcgaactccggtaccttcacttgtgtgtgt |
46838762 |
T |
 |
| Q |
162 |
gagtttataatggcttt |
178 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
46838761 |
gagtttataatggcttt |
46838745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 64 - 184
Target Start/End: Complemental strand, 54097569 - 54097453
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| |||||||||| ||||||||||||||||| ||||||||||||||||| |||||| ||| ||||||||||||||||||| |
|
|
| T |
54097569 |
atccagaagtcctagctcaaatggcaaaatgccgaaattgttaggccgg---atgccatgaccggggttggaaccccggt-cctccacttgtgtgtgtga |
54097474 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
54097473 |
gtttataatggctttgccatt |
54097453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 84 - 179
Target Start/End: Complemental strand, 28197093 - 28197001
Alignment:
| Q |
84 |
ctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttg |
179 |
Q |
| |
|
||||||||||| ||||||||||||||||| ||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28197093 |
ctggcaaaatgccgaaattgttaggccgg---atgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataatggctttg |
28197001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 63 - 184
Target Start/End: Complemental strand, 2789108 - 2788991
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| |||| ||| ||||||||||| ||||||| ||||||| | |||||||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
2789108 |
tatccagaagtcctagttcaactggcaaaatgccgaaattattaggcctg---atgccatgaccggggttcgaaccccggtacctccacttgtgt-tgtg |
2789013 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
2789012 |
agtttataatggctttgccatt |
2788991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 64 - 184
Target Start/End: Complemental strand, 6583364 - 6583246
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| ||||||||||| ||||||||||||||||| ||||||||| |||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
6583364 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccgg---atgccatgatcggggttcgaaccccggtgcctccacttgtgtgtgtga |
6583268 |
T |
 |
| Q |
164 |
g-tttataatggctttggcatt |
184 |
Q |
| |
|
| ||||| ||||||||| |||| |
|
|
| T |
6583267 |
gttttattatggctttgccatt |
6583246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 63 - 184
Target Start/End: Original strand, 8507930 - 8508048
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| ||||||| |||| |||||| ||||||||||||||||| |||||||||| ||||||| ||||| ||||||||||||| |||||||| |
|
|
| T |
8507930 |
tatccagaagtcttagctcaactggaaaaatgccgaaattgttaggccgg---atgccatgactggggttcaaaccccggtacctccacttatgtgtgtg |
8508026 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
8508027 |
agtttataatggctttgccatt |
8508048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 63 - 184
Target Start/End: Complemental strand, 12088412 - 12088294
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| |||| ||| ||| |||||||||||||||||||||||| |||| |||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
12088412 |
tatccagaagtcctagatcacttggaaaaatgtcgaaattgttaggccgg---atgctatgatcggggttcgaaccccggtacctccacttgtgtgtgtg |
12088316 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||| |||| |||| |
|
|
| T |
12088315 |
agtttataatggatttgtcatt |
12088294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 62 - 184
Target Start/End: Original strand, 35069310 - 35069431
Alignment:
| Q |
62 |
atatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccact--tgtgtgt |
159 |
Q |
| |
|
||||| |||||| ||| ||| ||||||||||| ||||||||||||||||| |||||||||||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
35069310 |
atatcaagaagtcttagttcaactggcaaaatgccgaaattgttaggccgg---atgccatgaccggggttcgaaccccggtacctccacttgtgtgtgt |
35069406 |
T |
 |
| Q |
160 |
gtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||||||| |||| |
|
|
| T |
35069407 |
gtgagtttataatggctttgtcatt |
35069431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 67 - 184
Target Start/End: Complemental strand, 50238966 - 50238852
Alignment:
| Q |
67 |
cagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtt |
166 |
Q |
| |
|
||||||| |||||||| |||| |||||||||||||||||||||||| ||||||||| ||| |||||||| | |||||||||||||||||||||||||| |
|
|
| T |
50238966 |
cagaagtcctagctcaactggtaaaatgtcgaaattgttaggccgg---atgccatgatcggagttcgaactccggtacctccacttgtgtgtgtgagtt |
50238870 |
T |
 |
| Q |
167 |
tataatggctttggcatt |
184 |
Q |
| |
|
|||||||| |||| |||| |
|
|
| T |
50238869 |
tataatggttttgccatt |
50238852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 10228956 - 10229073
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| || |||| ||||||||||| | |||||||||||||| ||| |||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
10228956 |
atccagaagtcttaactcaactggcaaaatgccaaaattgttaggccga---atgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtga |
10229052 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
10229053 |
gtttataatggctttgccatt |
10229073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 64 - 184
Target Start/End: Complemental strand, 27002869 - 27002752
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| |||||||| || ||||||||||| ||||| ||||||||||| | |||||||||| ||||||||||||||||||||||| |
|
|
| T |
27002869 |
atccagaagtcctagctcaactggcaaagtgccgaaattgttaagccgg---atgccatgaccagagttcgaaccccggtacctccacttgtgtgtgtga |
27002773 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||| |||| |||| |
|
|
| T |
27002772 |
gtttataatggttttgtcatt |
27002752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 84 - 184
Target Start/End: Original strand, 35359736 - 35359833
Alignment:
| Q |
84 |
ctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcat |
183 |
Q |
| |
|
||||||||||| ||||||||||||||||| ||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||| ||||| ||| |
|
|
| T |
35359736 |
ctggcaaaatgccgaaattgttaggccgg---atgccatgaccagggttcgaaccccggtacctccacttgtgtgtgtgagtttataatgactttgtcat |
35359832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 64 - 184
Target Start/End: Complemental strand, 43898092 - 43897975
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| | | ||||||| ||||||||||||||||| |||||||||||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
43898092 |
atccagaagtcctagctcaacagacaaaatgccgaaattgttaggccgg---atgccatgaccgggattcgaaccccggtacctccacttgtgtgtgtga |
43897996 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
||||| |||| ||||| |||| |
|
|
| T |
43897995 |
gtttacaatgactttgccatt |
43897975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 63 - 166
Target Start/End: Original strand, 2687557 - 2687657
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| |||||||| ||||||||||| ||||||||||||||||| ||| ||||| |||||||||||||||| |||||||||||||||||||| |
|
|
| T |
2687557 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccgg---atggcatgatcggggttcgaaccctgatacctccacttgtgtgtgtg |
2687653 |
T |
 |
| Q |
163 |
agtt |
166 |
Q |
| |
|
|||| |
|
|
| T |
2687654 |
agtt |
2687657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 68 - 184
Target Start/End: Original strand, 11312593 - 11312708
Alignment:
| Q |
68 |
agaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg--agt |
165 |
Q |
| |
|
|||||| |||||||| ||||||||||| ||||||||||||||||| |||| ||||||||||||||||||| |||||||||||||||||||||| ||| |
|
|
| T |
11312593 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccgg---atgctatgaccggggttcgaaccccggtacctccacttgtgtgtgtgtcagt |
11312689 |
T |
 |
| Q |
166 |
ttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||| ||| |||| |
|
|
| T |
11312690 |
ttataatggcattgccatt |
11312708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 53583960 - 53584079
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccact--tgtgtgtgt |
161 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||||||||||||||| ||||| ||||||||||||| ||||||| | |||||||||| ||||||||| |
|
|
| T |
53583960 |
atccagaagtcctagctcaactggcaaaatgtcgaaattgttaggc---cggattccatgaccggggtacgaacccagatacctccacttgtgtgtgtgt |
53584056 |
T |
 |
| Q |
162 |
gagtttataatggctttggcatt |
184 |
Q |
| |
|
|||| ||||||||||||| |||| |
|
|
| T |
53584057 |
gagtatataatggctttgtcatt |
53584079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 62 - 184
Target Start/End: Complemental strand, 6083272 - 6083154
Alignment:
| Q |
62 |
atatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgt |
161 |
Q |
| |
|
|||||||||||| |||||||| || |||||||| ||||||||||||||||| || ||||||||||| ||||||| | ||||||||||||||||||||| |
|
|
| T |
6083272 |
atatccagaagtcctagctcaactagcaaaatgccgaaattgttaggccgg---ataccatgaccggg-ttcgaactccggtacctccacttgtgtgtgt |
6083177 |
T |
 |
| Q |
162 |
gagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||| |||| |||| |
|
|
| T |
6083176 |
gagtttataatggttttgtcatt |
6083154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 90 - 184
Target Start/End: Complemental strand, 8128393 - 8128302
Alignment:
| Q |
90 |
aaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
8128393 |
aaatgccgaaattgttaggccgg---atgccatgatcggggttcgaaccccggtacctccacttgtgtgtgtgagtttataatggctttgccatt |
8128302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 62 - 184
Target Start/End: Original strand, 15003625 - 15003744
Alignment:
| Q |
62 |
atatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgt |
161 |
Q |
| |
|
|||||||||||| |||| ||| ||||||||||| | ||||||||||| ||| ||| |||||||||||||||||||| ||||||||||| | ||||||| |
|
|
| T |
15003625 |
atatccagaagtcctagttcaactggcaaaatgccaaaattgttaggtcgg---atgtcatgaccggggttcgaaccccggtacctccacctatgtgtgt |
15003721 |
T |
 |
| Q |
162 |
gagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||||| |||| |
|
|
| T |
15003722 |
gagtttataatggctttgccatt |
15003744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 63 - 184
Target Start/End: Original strand, 28266524 - 28266643
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| |||||||| ||| ||||||| |||||||||||||| || |||||||||||||||||||||| | ||| |||||||||||||||||| |
|
|
| T |
28266524 |
tatccagaagtcctagctcaactgacaaaatgccgaaattgttaggctgg---atgccatgaccggggttcgaactccggtgcctccacttgtgtgtgtg |
28266620 |
T |
 |
| Q |
163 |
ag-tttataatggctttggcatt |
184 |
Q |
| |
|
|| ||||||||||||||| |||| |
|
|
| T |
28266621 |
agttttataatggctttgccatt |
28266643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 62 - 184
Target Start/End: Original strand, 28731844 - 28731963
Alignment:
| Q |
62 |
atatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgt |
161 |
Q |
| |
|
||||| ||||||||||||||| ||| ||||||||||||||||||||| ||| ||||||||| ||||||||||| || ||||||| ||||||||||||| |
|
|
| T |
28731844 |
atatctagaagttctagctcaactgacaaaatgtcgaaattgttaggtcgg---atgccatgatcggggttcgaatcccggtaccttcacttgtgtgtgt |
28731940 |
T |
 |
| Q |
162 |
gagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||| |||| ||||| |||| |
|
|
| T |
28731941 |
gagtttacaatgactttgtcatt |
28731963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 62 - 184
Target Start/End: Original strand, 42296709 - 42296827
Alignment:
| Q |
62 |
atatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgt |
161 |
Q |
| |
|
|||||||||||| |||||||| ||| ||||||| | ||||||||||||||| ||| |||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
42296709 |
atatccagaagtcctagctcaactg-caaaatgccaaaattgttaggccgg---atgtcatgaccggggttcgaaccccggtacctccacttgtgtgtga |
42296804 |
T |
 |
| Q |
162 |
gagtttataatggctttggcatt |
184 |
Q |
| |
|
|| ||||||||||||||| |||| |
|
|
| T |
42296805 |
gaatttataatggctttgccatt |
42296827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 64 - 184
Target Start/End: Complemental strand, 5998909 - 5998794
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| ||| |||| || |||||||||||||| | || ||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5998909 |
atccagaagtcctagctcatctgacaaa-tgccgaaattgttaggctg----ataccatgaccggggttcgaaccccggtacctccacttgtgtgtgtga |
5998815 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
5998814 |
gtttataatggctttgccatt |
5998794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 17500926 - 17501043
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| ||| |||| |||| |||||| ||||||||||||||||| ||||||||||||||||||||| || ||| ||||||||||||||||| |
|
|
| T |
17500926 |
atccagaagtcctaactcaactggaaaaatgccgaaattgttaggccgg---atgccatgaccggggttcgaaaccaaatacatccacttgtgtgtgtga |
17501022 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
17501023 |
gtttataatggctttgccatt |
17501043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 60 - 184
Target Start/End: Complemental strand, 24274013 - 24273892
Alignment:
| Q |
60 |
ttatatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgt |
159 |
Q |
| |
|
||||||| |||||| ||| |||| ||| ||||||| ||||||||||||||||| |||||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
24274013 |
ttatatctagaagtcctaactcaactgacaaaatgccgaaattgttaggccgg---atgccatgactagggttcgaacttcggtacctccacttgtgtgt |
24273917 |
T |
 |
| Q |
160 |
gtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||||||| |||| |
|
|
| T |
24273916 |
gtgagtttataatggctttgccatt |
24273892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 62 - 174
Target Start/End: Complemental strand, 40193087 - 40192978
Alignment:
| Q |
62 |
atatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgt |
161 |
Q |
| |
|
|||||||||||| |||||| | |||| |||||||||||||||||||||||| ||||||||| ||| ||||||||||| |||||||| |||||||||| |
|
|
| T |
40193087 |
atatccagaagtcctagcttaactggtaaaatgtcgaaattgttaggccgg---atgccatgatcggagttcgaacccttatacctccatttgtgtgtgt |
40192991 |
T |
 |
| Q |
162 |
gagtttataatgg |
174 |
Q |
| |
|
||||||||||||| |
|
|
| T |
40192990 |
gagtttataatgg |
40192978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 48555835 - 48555952
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
||||| |||| ||| |||| ||||||||||| | ||||||||||||| | |||| ||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
48555835 |
atccataagtcctacctcaactggcaaaatgccaaaattgttaggccag---atgctatggccggggttcgaaccccggtacctccacttgtgtgtgtga |
48555931 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
48555932 |
gtttataatggctttgccatt |
48555952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 85 - 184
Target Start/End: Complemental strand, 33886478 - 33886382
Alignment:
| Q |
85 |
tggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||| ||||||||||||| ||| ||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
33886478 |
tggcaaaatgccgaaattgttaggtcgg---atgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataatggttttgccatt |
33886382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 61 - 184
Target Start/End: Original strand, 40559670 - 40559790
Alignment:
| Q |
61 |
tatatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtg |
160 |
Q |
| |
|
||||||||||||| |||||||| ||| |||||| ||||||||||||| ||| ||||| ||| |||||||||||| | | |||||||||||||||||| |
|
|
| T |
40559670 |
tatatccagaagtcctagctcaactgataaaatgccgaaattgttaggtcgg---atgccttgatcggggttcgaactccgatacctccacttgtgtgtg |
40559766 |
T |
 |
| Q |
161 |
tgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||||| |||| |
|
|
| T |
40559767 |
tgagtttataatggctttgtcatt |
40559790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 63 - 184
Target Start/End: Original strand, 24250723 - 24250842
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| |||||||| |||||||||| ||||||||||||||||| |||| ||||||||||||||||||| ||| ||| || ||||||||||| |
|
|
| T |
24250723 |
tatccagaagtcctagctcaattggcaaaatgccgaaattgttaggccgg---atgctatgaccggggttcgaaccccggtgccttcatttgtgtgtgtg |
24250819 |
T |
 |
| Q |
163 |
ag-tttataatggctttggcatt |
184 |
Q |
| |
|
|| ||||||||||||||| |||| |
|
|
| T |
24250820 |
agttttataatggctttgtcatt |
24250842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 63 - 173
Target Start/End: Complemental strand, 25118836 - 25118729
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
|||| |||||| ||||||| || |||||||||||||||||||||||||| ||||||||||| |||||||||||| ||||||||||| |||||||||| |
|
|
| T |
25118836 |
tatctagaagtcttagctcaactagcaaaatgtcgaaattgttaggccgg---atgccatgaccagggttcgaaccccggtacctccacctgtgtgtgtg |
25118740 |
T |
 |
| Q |
163 |
agtttataatg |
173 |
Q |
| |
|
| ||||||||| |
|
|
| T |
25118739 |
aatttataatg |
25118729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 90 - 184
Target Start/End: Original strand, 35240055 - 35240146
Alignment:
| Q |
90 |
aaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||| ||||||||||||||||| ||||| |||||||||||||||||| |||||||||||||||||||||||||| |||||||||||| |||| |
|
|
| T |
35240055 |
aaatgccgaaattgttaggccgg---atgccttgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttcataatggctttgccatt |
35240146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 67 - 172
Target Start/End: Complemental strand, 43904622 - 43904519
Alignment:
| Q |
67 |
cagaagttctagctcagctggcaaaa-tgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagt |
165 |
Q |
| |
|
|||||||||||||||| ||| |||| |||||||||||||||||||| |||||||||||||||||| |||||||||||||||| || ||||||||||| |
|
|
| T |
43904622 |
cagaagttctagctcaactgaaaaaaatgtcgaaattgttaggccgg---atgccatgaccggggttcaaaccctggtacctccatttatgtgtgtgagt |
43904526 |
T |
 |
| Q |
166 |
ttataat |
172 |
Q |
| |
|
||||||| |
|
|
| T |
43904525 |
ttataat |
43904519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 67 - 184
Target Start/End: Complemental strand, 46311569 - 46311457
Alignment:
| Q |
67 |
cagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtt |
166 |
Q |
| |
|
||||||| |||||||| |||| |||||||||||||||||||||||| |||| |||||||| |||||||||| |||||||||||||||||||||||| |
|
|
| T |
46311569 |
cagaagtcctagctcaactggtaaaatgtcgaaattgttaggccgg---atgctatgaccgg--ttcgaaccctaatacctccacttgtgtgtgtgagtt |
46311475 |
T |
 |
| Q |
167 |
tataatggctttggcatt |
184 |
Q |
| |
|
||||||| ||||| |||| |
|
|
| T |
46311474 |
tataatgactttgccatt |
46311457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 64 - 178
Target Start/End: Original strand, 46894812 - 46894923
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| ||| |||||| |||||||||||||||||| |||||||||||| ||||||||||| | ||||| ||||| ||||||||| |
|
|
| T |
46894812 |
atccagaagtcctagctcaactgacaaaatatcgaaattgttaggccgg---atgccatgaccgaggttcgaaccccgataccttcacttatgtgtgtga |
46894908 |
T |
 |
| Q |
164 |
gtttataatggcttt |
178 |
Q |
| |
|
||||||| ||||||| |
|
|
| T |
46894909 |
gtttatattggcttt |
46894923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 76 - 184
Target Start/End: Complemental strand, 9583541 - 9583435
Alignment:
| Q |
76 |
tagctcagctggcaaaa-tgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatgg |
174 |
Q |
| |
|
||||||| ||||||||| || ||||||||||||||||| |||| |||||||||||| |||||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
9583541 |
tagctcaactggcaaaaatgccgaaattgttaggccgg---atgctatgaccggggttagaaccccgatacctccacttgtgtgtgtgagtttataatgg |
9583445 |
T |
 |
| Q |
175 |
ctttggcatt |
184 |
Q |
| |
|
||||| |||| |
|
|
| T |
9583444 |
ctttgccatt |
9583435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 88 - 184
Target Start/End: Original strand, 9609955 - 9610049
Alignment:
| Q |
88 |
caaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgag-tttataatggctttggcatt |
184 |
Q |
| |
|
||||||| ||||||||||||||||| |||||||||||||||||||||||| ||| |||||||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
9609955 |
caaaatgccgaaattgttaggccgg---atgccatgaccggggttcgaaccccggtgcctccacttgtgtgtgtgagttttataatggctttgccatt |
9610049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 68 - 184
Target Start/End: Original strand, 40840171 - 40840285
Alignment:
| Q |
68 |
agaagttctagctcagctggcaaaa-tgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtt |
166 |
Q |
| |
|
|||||| |||||||| ||||||||| || ||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||| | | |
|
|
| T |
40840171 |
agaagtcctagctcaactggcaaaaatgccgaaattgttaggccgg---atgccatgaccggggttcgaaccccggtacctccacttgtgtgtgagttta |
40840267 |
T |
 |
| Q |
167 |
tataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||| |||| |
|
|
| T |
40840268 |
tataatggctttgccatt |
40840285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 67 - 184
Target Start/End: Original strand, 48191096 - 48191210
Alignment:
| Q |
67 |
cagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtt |
166 |
Q |
| |
|
||||||| |||||||| ||| |||||| ||||||||||||||||| ||| |||||||||||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
48191096 |
cagaagtcctagctcaactgctaaaatgccgaaattgttaggccgg---atgtcatgaccggggttcgaactccagtacctccacttgtgtgtgtgagtt |
48191192 |
T |
 |
| Q |
167 |
tataatggctttggcatt |
184 |
Q |
| |
|
|||||||| |||| |||| |
|
|
| T |
48191193 |
tataatggttttgtcatt |
48191210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 64 - 184
Target Start/End: Complemental strand, 14868983 - 14868867
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| |||||||| || |||||||||||||| || || |||||||||||||| |||||| ||||||||||||| ||||||||| |
|
|
| T |
14868983 |
atccagaagtcctagctcaactggcaaa-tgccgaaattgttaggctgg---ataccatgaccggggtttgaaccccggtacctccacttatgtgtgtga |
14868888 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||| |||| |
|
|
| T |
14868887 |
atttataatggctttgccatt |
14868867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 22371449 - 22371565
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| ||| |||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||| || |||||| |||||||||| | |
|
|
| T |
22371449 |
atccagaagtcctacctcaactggcaaaatgccgaaattgttaggc---cggatgccatgaccggggttcgaaccacagt-cctccatttgtgtgtgtaa |
22371544 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
22371545 |
gtttataatggctttgccatt |
22371565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 24657410 - 24657527
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| ||| |||| ||| ||||||| |||||||||||||| || |||||||| || |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
24657410 |
atccagaagtcctaactcaactgacaaaatgccgaaattgttaggcagg---atgccatggccagggttcgaaccccggtacctccacttgtgtgtgtga |
24657506 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
| ||||||||| |||| |||| |
|
|
| T |
24657507 |
gcttataatggttttgccatt |
24657527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 68 - 184
Target Start/End: Complemental strand, 53669836 - 53669723
Alignment:
| Q |
68 |
agaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagttt |
167 |
Q |
| |
|
||||||||||||||| |||| |||||| |||||||||||||||| |||||||||| || |||||||||| ||| ||| || |||||||||||||||| |
|
|
| T |
53669836 |
agaagttctagctcaactggtaaaatgctgaaattgttaggccgg---atgccatgactggagttcgaaccccggttccttcatttgtgtgtgtgagttt |
53669740 |
T |
 |
| Q |
168 |
ataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||| |||| |
|
|
| T |
53669739 |
ataatggctttgccatt |
53669723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 89 - 184
Target Start/End: Original strand, 9493522 - 9493614
Alignment:
| Q |
89 |
aaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||||||| || |||||||||| ||||||||||||| ||||||||||||||| ||||||||||||||||| ||||| |||| |
|
|
| T |
9493522 |
aaaatgtcgaaattgttaggctgg---atgccatgactggggttcgaaccccggtacctccacttgtatgtgtgagtttataatgactttgtcatt |
9493614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 65 - 184
Target Start/End: Original strand, 40639602 - 40639718
Alignment:
| Q |
65 |
tccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgag |
164 |
Q |
| |
|
|||||||||||||||||| |||| ||||| ||||||||||||||||| | ||| |||| ||||||||||||| | |||||||||||||||||||| |
|
|
| T |
40639602 |
tccagaagttctagctcaactggtaaaataccgaaattgttaggccgg---acgccttgacgggggttcgaacccccgcccctccacttgtgtgtgtgag |
40639698 |
T |
 |
| Q |
165 |
tttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||| |||| |
|
|
| T |
40639699 |
tttataatggctttgtcatt |
40639718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 76 - 178
Target Start/End: Complemental strand, 1218488 - 1218389
Alignment:
| Q |
76 |
tagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggc |
175 |
Q |
| |
|
||||||| |||| |||||| ||||||||||||||||| ||||||||| ||||||||||||| |||||||| |||||||||||| ||||||||||||| |
|
|
| T |
1218488 |
tagctcaactggtaaaatgccgaaattgttaggccgg---atgccatgatcggggttcgaacctcggtacctctacttgtgtgtgttagtttataatggc |
1218392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 64 - 174
Target Start/End: Original strand, 11751210 - 11751320
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaa-tgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccact--tgtgtgtg |
160 |
Q |
| |
|
||||| |||| |||||||| ||||||||| || ||||||||||||||||| ||||||| |||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
11751210 |
atccataagtcctagctcaactggcaaaaatgccgaaattgttaggccgg---atgccatcaccggggttcgaaccccggtacctccacttgtgtgtgtg |
11751306 |
T |
 |
| Q |
161 |
tgagtttataatgg |
174 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
11751307 |
tgagtttataatgg |
11751320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 75 - 184
Target Start/End: Complemental strand, 16687666 - 16687562
Alignment:
| Q |
75 |
ctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatgg |
174 |
Q |
| |
|
|||||||| | ||||||||| ||||||||||||||||| ||||||||||||||||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
16687666 |
ctagctcaaccggcaaaatgccgaaattgttaggccggac----ccatgaccggggttcgaacccaggtacctcca-ttgtgtgtgtgagtttataatgg |
16687572 |
T |
 |
| Q |
175 |
ctttggcatt |
184 |
Q |
| |
|
||||| |||| |
|
|
| T |
16687571 |
ctttgtcatt |
16687562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #77
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 63 - 184
Target Start/End: Original strand, 30703088 - 30703207
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaa-tgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgt |
161 |
Q |
| |
|
|||| |||||| |||||||| |||||||| | ||||||||||||||| || ||| |||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
30703088 |
tatcgagaagtcctagctcaattggcaaaaatatcgaaattgttaggctgg---atgtcatgaccggggttcgaaccccgttacctccacttgtgtgtga |
30703184 |
T |
 |
| Q |
162 |
gagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||||| |||| |
|
|
| T |
30703185 |
gagtttataatggctttgccatt |
30703207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #78
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 63 - 184
Target Start/End: Original strand, 17373669 - 17373787
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
|||||| |||| |||||||||||| |||||| ||||||||||| ||||| |||||||||| | ||||||||| | | |||||||||||||||||||| |
|
|
| T |
17373669 |
tatccacaagtcttagctcagctggtaaaatgccgaaattgttaagccgg---atgccatgactgaggttcgaactccgctacctccacttgtgtgtgtg |
17373765 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
| ||||||||||||||| |||| |
|
|
| T |
17373766 |
aatttataatggctttgccatt |
17373787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #79
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 75 - 184
Target Start/End: Original strand, 32635389 - 32635495
Alignment:
| Q |
75 |
ctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatgg |
174 |
Q |
| |
|
|||||| | ||||||||||||||||||| ||||| ||| ||| ||||| |||||||||||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
32635389 |
ctagcttaactggcaaaatgtcgaaattattaggtcgg---atgtcatgatcggggttcgaaccccggtacctccacttgtgtgtgcgagtttataatga |
32635485 |
T |
 |
| Q |
175 |
ctttggcatt |
184 |
Q |
| |
|
||||| |||| |
|
|
| T |
32635486 |
ctttgtcatt |
32635495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #80
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 37124215 - 37124333
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||| ||||||||||| |||||||||||||||| ||||||||||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
37124215 |
atccagaagtcatagctctactggcaaaatgccgaaattgttaggccga---atgccatgaccggggttcgaacctcggtacctccccttgtgtgtgtga |
37124311 |
T |
 |
| Q |
164 |
g-tttataatggctttggcatt |
184 |
Q |
| |
|
| ||||||||| ||||| |||| |
|
|
| T |
37124312 |
gttttataatgactttgccatt |
37124333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #81
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 113 - 184
Target Start/End: Complemental strand, 38486042 - 38485971
Alignment:
| Q |
113 |
cggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||| ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
38486042 |
cggatgctatgaccggggttcgaactccggtacctccacttgtgtgtgtgagtttataatggctttgccatt |
38485971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #82
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 68 - 184
Target Start/End: Complemental strand, 44879358 - 44879245
Alignment:
| Q |
68 |
agaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggt-acctccacttgtgtgtgtgagtt |
166 |
Q |
| |
|
|||||| |||| ||| ||||||||||||||||||||||||||| | ||| |||||||||||||| ||||| ||| ||||||||||||||||||||||| |
|
|
| T |
44879358 |
agaagtcctagttcaactggcaaaatgtcgaaattgttaggccag---atgtcatgaccggggttc-aaccccggtcacctccacttgtgtgtgtgagtt |
44879263 |
T |
 |
| Q |
167 |
tataatggctttggcatt |
184 |
Q |
| |
|
|||||||| |||| |||| |
|
|
| T |
44879262 |
tataatggttttgccatt |
44879245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #83
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 91 - 184
Target Start/End: Complemental strand, 2096687 - 2096595
Alignment:
| Q |
91 |
aatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtg--tgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||| |||||||||||||| || |||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||| |||| |
|
|
| T |
2096687 |
aatgccgaaattgttaggctgg---atgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgtgagtttataatggctttgccatt |
2096595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #84
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 96 - 184
Target Start/End: Original strand, 7552626 - 7552711
Alignment:
| Q |
96 |
cgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
7552626 |
cgaaattgttaggccgg---atgccgtgaccggggttcgaaccccaatacctccacttgtgtgtgtgagtttataatggctttgccatt |
7552711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #85
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 65 - 184
Target Start/End: Original strand, 37312528 - 37312644
Alignment:
| Q |
65 |
tccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgag |
164 |
Q |
| |
|
||||||||| |||||||| |||| ||||| ||||||||||||||||| | ||| |||| ||||||||||||| | |||||||||||||||||||| |
|
|
| T |
37312528 |
tccagaagtcctagctcaactggtaaaataccgaaattgttaggccgg---acgccttgacgggggttcgaacccccgcccctccacttgtgtgtgtgag |
37312624 |
T |
 |
| Q |
165 |
tttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||| |||| |
|
|
| T |
37312625 |
tttataatggctttgccatt |
37312644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #86
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 63 - 184
Target Start/End: Original strand, 8826623 - 8826742
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| |||||||| | | ||||||| |||||||||||| |||| |||| |||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
8826623 |
tatccagaagtcctagctcaacggacaaaatgccgaaattgttagaccgg---atgctatgatcggggctcgaaccccggtacctccacttgtgtgtgtg |
8826719 |
T |
 |
| Q |
163 |
ag-tttataatggctttggcatt |
184 |
Q |
| |
|
|| ||||||||| ||||| |||| |
|
|
| T |
8826720 |
agttttataatgactttgccatt |
8826742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #87
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 120 - 184
Target Start/End: Original strand, 11076457 - 11076521
Alignment:
| Q |
120 |
catgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
11076457 |
catgaccggggttcgaaccccgatacctccacttgtgtgtgtgagtttataatggctttgccatt |
11076521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #88
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 75 - 184
Target Start/End: Original strand, 2558757 - 2558863
Alignment:
| Q |
75 |
ctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatgg |
174 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||| ||| ||| ||||| ||||||| |||||| | ||||||||||| |||||||||||||||||||| |
|
|
| T |
2558757 |
ctagctcaactggcaaaatgctgaaattgttaggtcgg---atgtcatgatcggggtttgaaccccgatacctccacttatgtgtgtgagtttataatgg |
2558853 |
T |
 |
| Q |
175 |
ctttggcatt |
184 |
Q |
| |
|
||||| |||| |
|
|
| T |
2558854 |
ctttgccatt |
2558863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #89
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 11249959 - 11250074
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
||||| |||| |||||||| |||| |||||| |||||||||||| ||| ||||||||| ||||||||||||||||||||||| ||| ||||||||| |
|
|
| T |
11249959 |
atccacaagtcctagctcaactggtaaaatgcagaaattgttaggtcgg---atgccatgatcggggttcgaaccctggtacctctact--tgtgtgtga |
11250053 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||| ||||| |||| |
|
|
| T |
11250054 |
gtttataatgactttgtcatt |
11250074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #90
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 67 - 184
Target Start/End: Original strand, 12948812 - 12948925
Alignment:
| Q |
67 |
cagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtt |
166 |
Q |
| |
|
||||||| |||||||| |||| |||||| ||||||||||||||||| ||||||||| |||||||||||||| | ||| |||||||||||||| | || |
|
|
| T |
12948812 |
cagaagtcctagctcaactggtaaaatgacgaaattgttaggccgg---atgccatgatcggggttcgaaccccgatacttccacttgtgtgtgag-ttt |
12948907 |
T |
 |
| Q |
167 |
tataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||| |||| |
|
|
| T |
12948908 |
tataatggctttgccatt |
12948925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #91
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 63 - 184
Target Start/End: Complemental strand, 19921442 - 19921324
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| |||||||| |||||||||| |||||||||||| ||| |||||||||| | ||||||||||| || ||||||||| |||||||| |
|
|
| T |
19921442 |
tatccagaagtcctagctcaattggcaaaatgctgaaattgttaggtcgg---atgccatgactgaggttcgaaccccagttcctccacttatgtgtgtg |
19921346 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||| ||||| |||| |
|
|
| T |
19921345 |
agtttataatgactttgccatt |
19921324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #92
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 2900254 - 2900371
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| ||||||| ||||||||||| ||||||||||| ||||| ||| ||| |||| ||| ||| |||||||| ||||||||||||||||| |
|
|
| T |
2900254 |
atccagaagtcctagctccactggcaaaatgccgaaattgttaagccgg---atgtcataaccgaagtttgaatcctggtacatccacttgtgtgtgtga |
2900350 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||| |||||| |||| |
|
|
| T |
2900351 |
gtttataatagctttgccatt |
2900371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #93
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 96 - 184
Target Start/End: Complemental strand, 34481889 - 34481804
Alignment:
| Q |
96 |
cgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||||||||| |||||||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
34481889 |
cgaaattgttaggccgg---atgacatgaccggggttcgaacttcggtacctctacttgtgtgtgtgagtttataatggctttgccatt |
34481804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #94
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 64 - 184
Target Start/End: Complemental strand, 44037573 - 44037456
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| ||||||||||| |||||||||||| | |||||| | ||| || |||||||| || |||||||| |||| ||||||||| |
|
|
| T |
44037573 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttag---gtcggatgtcgtgatcgaggttcgaatcccggtacctctacttatgtgtgtga |
44037477 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||| |||| |||| |
|
|
| T |
44037476 |
gtttataatggttttgtcatt |
44037456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #95
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 115 - 184
Target Start/End: Original strand, 43426615 - 43426684
Alignment:
| Q |
115 |
gatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||||||| ||||| ||||||||||||||||||| |||| |
|
|
| T |
43426615 |
gatgccatgaccggagttcgaaccccggtacctccacttatgtgtatgagtttataatggctttgccatt |
43426684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #96
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 113 - 184
Target Start/End: Original strand, 1339265 - 1339336
Alignment:
| Q |
113 |
cggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||| ||||| |||||||||||||| ||| |||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
1339265 |
cggatgtcatgatcggggttcgaaccccggtccctccacttgtgtgtgtgagtttataatggttttgtcatt |
1339336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #97
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 63 - 184
Target Start/End: Original strand, 38085804 - 38085922
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||| | |||||||| ||| |||||||||||||||||||||| || ||| ||||| ||||| |||||||| |||| ||||||||||||| ||| |
|
|
| T |
38085804 |
tatccagaaatcctagctcaactgacaaaatgtcgaaattgttaggc---cgaatgacatgatcggggctcgaaccccggtaactccacttgtgtgcgtg |
38085900 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
| |||| |||| ||||| |||| |
|
|
| T |
38085901 |
aatttaaaatgactttgccatt |
38085922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #98
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 75 - 184
Target Start/End: Complemental strand, 45475350 - 45475244
Alignment:
| Q |
75 |
ctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatgg |
174 |
Q |
| |
|
|||||||| |||| ||||| ||||||||||||||||| ||| |||| ||||||||||||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
45475350 |
ctagctcaactggtaaaataccgaaattgttaggccgg---atgttatgattggggttcgaaccccgatacctccacttgtgtgtgtgagtttataatgg |
45475254 |
T |
 |
| Q |
175 |
ctttggcatt |
184 |
Q |
| |
|
|||| |||| |
|
|
| T |
45475253 |
ttttgccatt |
45475244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #99
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 88 - 184
Target Start/End: Original strand, 16135025 - 16135118
Alignment:
| Q |
88 |
caaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||| ||||||||||||| ||| ||| || || |||||||||||||| | ||||||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
16135025 |
caaaatgccgaaattgttaggtcgg---atgtcaagatcggggttcgaaccccgctacctccacttatgtgtgtgagtttataatggctttgtcatt |
16135118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #100
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 18271576 - 18271692
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||||||| |||| ||| ||||||| ||||||||||||| ||| ||||||||| |||| || ||| | ||||||||||||||||| ||||| |
|
|
| T |
18271576 |
atccagaagttctaactcaactgacaaaatgccgaaattgttaggtcgg---atgccatgatcgggttt-gaatctcggtacctccacttgtgtatgtga |
18271671 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||| ||||| |||| |
|
|
| T |
18271672 |
gtttataatgactttgccatt |
18271692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #101
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 131 - 184
Target Start/End: Original strand, 19163697 - 19163750
Alignment:
| Q |
131 |
ttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
19163697 |
ttcgaaccccggtacctccacttgtgtgtgtgagtttataatggctttgccatt |
19163750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #102
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 75 - 178
Target Start/End: Original strand, 43967934 - 43968033
Alignment:
| Q |
75 |
ctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatgg |
174 |
Q |
| |
|
|||||||| |||| ||| || |||||||||||||||| ||| ||||| | |||||||||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
43967934 |
ctagctcaactggtaaagtgctgaaattgttaggccgg---atgtcatgatcagggttcgaaccccggtac-tccacttgtgtgtgtgagtttataatgg |
43968029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #103
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 85 - 184
Target Start/End: Complemental strand, 46800140 - 46800045
Alignment:
| Q |
85 |
tggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||| |||||||||||| |||||| |||||| |||||| |||||| ||||||||||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
46800140 |
tggcaaaatgccgaaattgttag---atcggatgtcatgactggggtttgaaccc-ggtacctccacttgtgtgtgtgaatttataatggctttgccatt |
46800045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #104
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 119 - 179
Target Start/End: Original strand, 30740911 - 30740971
Alignment:
| Q |
119 |
ccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttg |
179 |
Q |
| |
|
|||||||| |||||||||||| ||||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
30740911 |
ccatgaccagggttcgaaccccggtacctccacgtatgtgtgtgagtttataatggctttg |
30740971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #105
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 63 - 184
Target Start/End: Original strand, 47570281 - 47570399
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
|||||| |||| |||||||| || ||||||||| ||||||||| ||||| ||| ||| | | |||||||||||| |||||||||| || |||||||| |
|
|
| T |
47570281 |
tatccaaaagtcctagctcaactcacaaaatgtcaaaattgttaagccgg---atgtcataatcagggttcgaaccccggtacctccatttatgtgtgtg |
47570377 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||| ||||| |||| |
|
|
| T |
47570378 |
agtttataatgactttgtcatt |
47570399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #106
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 89 - 184
Target Start/End: Original strand, 1562819 - 1562909
Alignment:
| Q |
89 |
aaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||| ||||||||||||| ||| ||| ||||| |||||||||||||| ||||||| |||| ||||||||||||||||||||||||| |||| |
|
|
| T |
1562819 |
aaaatgccgaaattgttaggtcgg---atgtcatgatcggggttcgaaccccggtaccttcact--tgtgtgtgagtttataatggctttgccatt |
1562909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #107
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 96 - 184
Target Start/End: Complemental strand, 5350015 - 5349930
Alignment:
| Q |
96 |
cgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||| || |||||| |||||||||||||| |||||||||| || ||| ||||||||||||||| ||||| |||| |
|
|
| T |
5350015 |
cgaaattgttaggccgg---ataccatgatcggggttcgaaccccggtacctccatttatgtttgtgagtttataatgactttgccatt |
5349930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #108
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 119 - 178
Target Start/End: Complemental strand, 32597424 - 32597363
Alignment:
| Q |
119 |
ccatgaccggggttcgaaccctggtacctccacttgtgtg--tgtgagtttataatggcttt |
178 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
32597424 |
ccatgaccggggttcgaatcccggtacctccacttgtgtgtgtgtgagtttataatggcttt |
32597363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #109
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 89 - 172
Target Start/End: Complemental strand, 6419769 - 6419689
Alignment:
| Q |
89 |
aaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataat |
172 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||||| | ||||||||| |||||| |||||||| |||||||||||||||| |
|
|
| T |
6419769 |
aaaatgtcgaaattgttaggccgg---atgtcatgaccagcgttcgaaccgcggtacccccacttgtatgtgtgagtttataat |
6419689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #110
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 62 - 173
Target Start/End: Original strand, 23878943 - 23879051
Alignment:
| Q |
62 |
atatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgt |
161 |
Q |
| |
|
||||||| |||| |||||||| |||| |||||| | ||||||||||||| | ||| |||||| || |||||||||| | ||||||||||| ||||||| |
|
|
| T |
23878943 |
atatccacaagtcctagctcaactggaaaaatgcctaaattgttaggccag---atgtcatgactggagttcgaaccccgatacctccacttatgtgtgt |
23879039 |
T |
 |
| Q |
162 |
gagtttataatg |
173 |
Q |
| |
|
||||||| |||| |
|
|
| T |
23879040 |
gagtttacaatg |
23879051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #111
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 89 - 172
Target Start/End: Original strand, 29216830 - 29216910
Alignment:
| Q |
89 |
aaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataat |
172 |
Q |
| |
|
|||||||||||||||||||||||| || | |||||||| |||| ||||| |||||| |||||| |||||||||||||||||| |
|
|
| T |
29216830 |
aaaatgtcgaaattgttaggccgg---atactatgaccggagttcaaaccccggtaccgccacttatgtgtgtgagtttataat |
29216910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #112
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 77 - 184
Target Start/End: Original strand, 46828906 - 46829010
Alignment:
| Q |
77 |
agctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggct |
176 |
Q |
| |
|
|||||| ||| ||||||||||||||| ||||||||| ||||||||||| |||| |||||| | |||||||||||||| || |||||||||||| || |
|
|
| T |
46828906 |
agctcaactgacaaaatgtcgaaattattaggccgg---atgccatgaccatggtttgaaccccagaacctccacttgtgtatgcgagtttataatgtct |
46829002 |
T |
 |
| Q |
177 |
ttggcatt |
184 |
Q |
| |
|
||| |||| |
|
|
| T |
46829003 |
ttgtcatt |
46829010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #113
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 64 - 173
Target Start/End: Original strand, 19961368 - 19961475
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctcca-cttgtgtgtgtg |
162 |
Q |
| |
|
|||||||||| ||| |||| ||| |||||||||||||||||||| | |||||| |||||| |||||||| |||| |||| ||||| |||||||| | | |
|
|
| T |
19961368 |
atccagaagtcctaactcaactgacaaaatgtcgaaattgttag---gtcggatgtcatgactggggttcgtaccccggtatctccaccttgtgtgcgag |
19961464 |
T |
 |
| Q |
163 |
agtttataatg |
173 |
Q |
| |
|
||||||||||| |
|
|
| T |
19961465 |
agtttataatg |
19961475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #114
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 64 - 170
Target Start/End: Original strand, 47408839 - 47408945
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttc-gaaccctggtacctccact--tgtgtgtg |
160 |
Q |
| |
|
|||||||||| |||||||| || |||||||| |||||||||||||| ||||| |||||| ||||||| |||| | |||||||||||| |||||||| |
|
|
| T |
47408839 |
atccagaagtcctagctcaactagcaaaatgccgaaattgttaggc---cggataccatgaatggggttcggaactccggtacctccacttatgtgtgtg |
47408935 |
T |
 |
| Q |
161 |
tgagtttata |
170 |
Q |
| |
|
|||||||||| |
|
|
| T |
47408936 |
tgagtttata |
47408945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #115
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 67 - 184
Target Start/End: Complemental strand, 51112589 - 51112478
Alignment:
| Q |
67 |
cagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtt |
166 |
Q |
| |
|
||||||| |||||||| |||||||| || |||||||| |||||||| | | |||||||||||||||||||| || || ||||||||||||| |||| |
|
|
| T |
51112589 |
cagaagtcctagctcaactggcaaa-tgccgaaattgctaggccgg---acgtcatgaccggggttcgaaccccagtgcccccacttgtgtgtg--agtt |
51112496 |
T |
 |
| Q |
167 |
tataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||| |||| |
|
|
| T |
51112495 |
tataatggctttgccatt |
51112478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #116
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 113 - 184
Target Start/End: Original strand, 36518145 - 36518216
Alignment:
| Q |
113 |
cggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||| ||| |||||||| | | ||| ||||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
36518145 |
cggatgccataaccagggttcgacctccggttcctccacttgtgtgtgtgagtttataatgactttgtcatt |
36518216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #117
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 64 - 184
Target Start/End: Complemental strand, 40418604 - 40418489
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| | || |||||| |||||||||||||| ||| ||||| |||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
40418604 |
atccagaagtcctagctcaacaggaaaaatgctgaaattgttaggccaa---atgtcatgatcggggttcgaaccccggtacctccacttgtg--tgtga |
40418510 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|| ||||||||| ||| |||| |
|
|
| T |
40418509 |
gtatataatggcgttgtcatt |
40418489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #118
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 113 - 184
Target Start/End: Original strand, 51402868 - 51402939
Alignment:
| Q |
113 |
cggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||| || || ||| |||||||| | |||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
51402868 |
cggatgtcaagaacggagttcgaactccggtacctccacttgtgtgtgtgagtttataatggttttgtcatt |
51402939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #119
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 65 - 184
Target Start/End: Complemental strand, 10071645 - 10071528
Alignment:
| Q |
65 |
tccagaagttctagctcagctggcaaaa-tgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||| |||| |||||||| ||| ||||| |||| |||||||||||| || |||||||| |||||||||||||| |||| |||||||| |||||| |
|
|
| T |
10071645 |
tccacaagtcctagctcaactgacaaaaatgtcaaaattgttaggctgg---atgccatggtcggggttcgaaccccaacacctgcacttgtgcgtgtga |
10071549 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
10071548 |
gtttataatggctttgccatt |
10071528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #120
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 68 - 184
Target Start/End: Original strand, 36540108 - 36540221
Alignment:
| Q |
68 |
agaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagttt |
167 |
Q |
| |
|
|||||| |||| ||| ||| |||||||||||||||||||||| | ||| |||||| | ||||||||||| | ||| | |||||| |||||||||||| |
|
|
| T |
36540108 |
agaagtcctagttcaagtggtaaaatgtcgaaattgttaggccag---atgtcatgactgaggttcgaaccccgatactttcacttgcgtgtgtgagttt |
36540204 |
T |
 |
| Q |
168 |
ataatggctttggcatt |
184 |
Q |
| |
|
|||||| ||||| |||| |
|
|
| T |
36540205 |
ataatgactttgtcatt |
36540221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #121
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 120 - 174
Target Start/End: Original strand, 44791760 - 44791814
Alignment:
| Q |
120 |
catgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatgg |
174 |
Q |
| |
|
||||| |||||||||||||| | ||||||||||| |||||||||||||||||||| |
|
|
| T |
44791760 |
catgatcggggttcgaaccccgttacctccacttatgtgtgtgagtttataatgg |
44791814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #122
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 65 - 184
Target Start/End: Complemental strand, 27719244 - 27719128
Alignment:
| Q |
65 |
tccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgag |
164 |
Q |
| |
|
||||||||| ||||||| | || |||||||||||||||||| | ||| || ||||||||| ||||||||| | |||||||| || ||||||||| |
|
|
| T |
27719244 |
tccagaagtcatagctcaacgggtaaaatgtcgaaattgttaagtcgg---atatcatgaccggagttcgaacctcgatacctccatttatgtgtgtgaa |
27719148 |
T |
 |
| Q |
165 |
tttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||| |||| |
|
|
| T |
27719147 |
tttataatggctttgccatt |
27719128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #123
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 89 - 172
Target Start/End: Complemental strand, 46316581 - 46316501
Alignment:
| Q |
89 |
aaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataat |
172 |
Q |
| |
|
|||||| ||||||||||||| ||| ||| |||||| ||||| |||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
46316581 |
aaaatgccgaaattgttaggtcgg---atgtcatgactagggtttgaaccctgatacctctacttgtgtgtgtgagtttataat |
46316501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #124
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 63 - 161
Target Start/End: Complemental strand, 18462086 - 18461991
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgt |
161 |
Q |
| |
|
|||||||||||||| ||||| |||| |||||||||||||| |||| | |||||| || || |||||||||||||| ||||||||||| ||||||| |
|
|
| T |
18462086 |
tatccagaagttctggctcaactggtaaaatgtcgaaattattagac---cggatgtcaagatcggggttcgaacccccatacctccacttatgtgtgt |
18461991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #125
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 120 - 179
Target Start/End: Original strand, 32956822 - 32956881
Alignment:
| Q |
120 |
catgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttg |
179 |
Q |
| |
|
|||||||||||||||||||| ||||||||| || ||||||||| |||||||| |||||| |
|
|
| T |
32956822 |
catgaccggggttcgaaccccagtacctccatttatgtgtgtgaatttataatagctttg |
32956881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #126
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 96 - 184
Target Start/End: Complemental strand, 48209528 - 48209443
Alignment:
| Q |
96 |
cgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||| || |||||||| |||| |||||||||| ||||||| ||| | |||||||||| |||||||| ||||| |||| |
|
|
| T |
48209528 |
cgaaattgttaggc---cgaatgccatggccggagttcgaaccccggtaccttcacgtatgtgtgtgagcttataatgactttgtcatt |
48209443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #127
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 63 - 184
Target Start/End: Complemental strand, 8792860 - 8792743
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaa-tgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgt |
161 |
Q |
| |
|
||||||||||| |||||||| | || |||| || |||||||||||||| || ||||||||| ||||||||||||| ||||| | |||||||| ||| |
|
|
| T |
8792860 |
tatccagaagtcctagctcaaccggtaaaaatgccgaaattgttaggctgg---atgccatgattggggttcgaaccccggtacattcacttgtg--tgt |
8792766 |
T |
 |
| Q |
162 |
gagtttataatggctttggcatt |
184 |
Q |
| |
|
| ||||||||| |||||| |||| |
|
|
| T |
8792765 |
gggtttataatagctttgccatt |
8792743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #128
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 143 - 184
Target Start/End: Original strand, 13777547 - 13777588
Alignment:
| Q |
143 |
tacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
13777547 |
tacctccactcgtgtgtgtgagtttataatggctttgccatt |
13777588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #129
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 129 - 178
Target Start/End: Complemental strand, 32946420 - 32946371
Alignment:
| Q |
129 |
ggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggcttt |
178 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
32946420 |
ggttcgaaccacggtacctccacttgcgtgtgagagtttataatggcttt |
32946371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #130
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 62 - 184
Target Start/End: Original strand, 39172037 - 39172154
Alignment:
| Q |
62 |
atatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgt |
161 |
Q |
| |
|
||||| |||||| ||||| | ||||||||||||| |||||||||||| || ||| ||||| ||||||| ||||| ||||||||| | ||||||| |
|
|
| T |
39172037 |
atatcaagaagtcctagcataactggcaaaatgtcaaaattgttaggc---cgaatgtcatgattggggttcaaaccccagtacctcca--tttgtgtgt |
39172131 |
T |
 |
| Q |
162 |
gagtttataatggctttggcatt |
184 |
Q |
| |
|
|| ||||||||||||||| |||| |
|
|
| T |
39172132 |
gaatttataatggctttgccatt |
39172154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #131
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 120 - 179
Target Start/End: Original strand, 21129098 - 21129158
Alignment:
| Q |
120 |
catgaccggggttcgaaccctggtacctccac-ttgtgtgtgtgagtttataatggctttg |
179 |
Q |
| |
|
||||| |||||||||||||| |||||||| || |||||| ||||||||||| ||||||||| |
|
|
| T |
21129098 |
catgatcggggttcgaaccccggtacctctactttgtgtttgtgagtttatgatggctttg |
21129158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #132
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 58 - 176
Target Start/End: Complemental strand, 32630750 - 32630635
Alignment:
| Q |
58 |
atttatatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgt |
157 |
Q |
| |
|
|||||||| ||||||| ||||||| |||| |||||| ||||||||| || || ||| ||||| || ||||||||| ||||||||||||| ||| |
|
|
| T |
32630750 |
atttatattcagaagtcatagctcaactggtaaaatgctaaaattgttaagctgg---atgtcatgattggagttcgaacctcggtacctccacttatgt |
32630654 |
T |
 |
| Q |
158 |
gtgtgagtttataatggct |
176 |
Q |
| |
|
||||||||| ||||||||| |
|
|
| T |
32630653 |
gtgtgagttaataatggct |
32630635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #133
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 89 - 184
Target Start/End: Original strand, 34844013 - 34844109
Alignment:
| Q |
89 |
aaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccact----tgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||| |||||||||| ||||| | |||||||||| ||||||||||| || |||||| || ||||||||||||||||||||||| ||| |||| |
|
|
| T |
34844013 |
aaaatgttgaaattgttatgccgg---acgccatgaccgaggttcgaaccccggcacctccccttgtgtgtgtgtgtgagtttataatggcattgccatt |
34844109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #134
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 144 - 184
Target Start/End: Original strand, 41921573 - 41921613
Alignment:
| Q |
144 |
acctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
41921573 |
acctccacttgtttgtgtgagtttataatggctttgccatt |
41921613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #135
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 120 - 184
Target Start/End: Original strand, 35966290 - 35966358
Alignment:
| Q |
120 |
catgaccggggttcgaaccctggtacctcca----cttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||| ||||||||||| |||||||||| |||||||||||||||||||||| ||||| |||| |
|
|
| T |
35966290 |
catgaccgaggttcgaaccccggtacctccaattgtttgtgtgtgtgagtttataatgactttgtcatt |
35966358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #136
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 68 - 184
Target Start/End: Complemental strand, 4039832 - 4039720
Alignment:
| Q |
68 |
agaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagttt |
167 |
Q |
| |
|
||||||| ||||||| || | |||||||||||||| |||| | |||| |||||||| |||||||||||| || |||| |||||| | ||||||||| |
|
|
| T |
4039832 |
agaagttttagctcaactagtaaaatgtcgaaattattag---gtcggacgccatgactagggttcgaaccccggcgcctctacttgt-tatgtgagttt |
4039737 |
T |
 |
| Q |
168 |
ataatggctttggcatt |
184 |
Q |
| |
|
|||||||| ||| |||| |
|
|
| T |
4039736 |
ataatggccttgtcatt |
4039720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #137
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 113 - 178
Target Start/End: Original strand, 4659583 - 4659649
Alignment:
| Q |
113 |
cggatgccatgaccggggttcgaaccctggtacctccac-ttgtgtgtgtgagtttataatggcttt |
178 |
Q |
| |
|
|||||| | ||| ||| |||||||||||| ||||||||| || ||||||||||||||||||| |||| |
|
|
| T |
4659583 |
cggatgtcttgatcggtgttcgaaccctgatacctccactttatgtgtgtgagtttataatgacttt |
4659649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #138
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 150 - 184
Target Start/End: Complemental strand, 11056118 - 11056084
Alignment:
| Q |
150 |
acttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |
|
|
| T |
11056118 |
acttgtgtgtgtgagtttataatggctttgtcatt |
11056084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #139
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 64 - 106
Target Start/End: Complemental strand, 21402787 - 21402745
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgtta |
106 |
Q |
| |
|
|||||||||| |||||||| ||||||||||| ||||||||||| |
|
|
| T |
21402787 |
atccagaagtcctagctcaactggcaaaatgccgaaattgtta |
21402745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #140
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 135 - 184
Target Start/End: Complemental strand, 26764526 - 26764476
Alignment:
| Q |
135 |
aaccctggtacctccacttgtgtgtgtgag-tttataatggctttggcatt |
184 |
Q |
| |
|
||||| ||| |||||||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
26764526 |
aaccccggtgcctccacttgtgtgtgtgagttttataatggctttgccatt |
26764476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #141
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 123 - 172
Target Start/End: Original strand, 42446459 - 42446506
Alignment:
| Q |
123 |
gaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataat |
172 |
Q |
| |
|
|||||| |||||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
42446459 |
gaccggagttcgaaccccggtacctccact--tgtgtgtgagtttataat |
42446506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #142
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 128 - 174
Target Start/End: Complemental strand, 42683122 - 42683076
Alignment:
| Q |
128 |
gggttcgaaccctggtacctccacttgtgtgtgtgagtttataatgg |
174 |
Q |
| |
|
|||||||||||| | ||| ||||||| |||||||||||||||||||| |
|
|
| T |
42683122 |
gggttcgaaccccgatacttccacttatgtgtgtgagtttataatgg |
42683076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #143
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 123 - 179
Target Start/End: Complemental strand, 7131576 - 7131519
Alignment:
| Q |
123 |
gaccggggttcgaaccctggtacctccactt-gtgtgtgtgagtttataatggctttg |
179 |
Q |
| |
|
||||||||||||||| | ||||||||||| |||||||||||||||| ||||||||| |
|
|
| T |
7131576 |
gaccggggttcgaacttcgatacctccactttgtgtgtgtgagtttatgatggctttg |
7131519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #144
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 122 - 184
Target Start/End: Complemental strand, 21507531 - 21507473
Alignment:
| Q |
122 |
tgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||| || || ||||||||||| ||||||||||||||||||||| |||| |
|
|
| T |
21507531 |
tgaccggggttcgaaacccggcacctccacttg----tgtgagtttataatggctttgccatt |
21507473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #145
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 116 - 184
Target Start/End: Original strand, 55068975 - 55069043
Alignment:
| Q |
116 |
atgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||| |||| ||||||||| | ||||||||||| | ||||| ||||||||| | ||||| |||| |
|
|
| T |
55068975 |
atgccatgatcgggattcgaaccccgatacctccacttatatgtgtaagtttataaagactttgccatt |
55069043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 89; Significance: 7e-43; HSPs: 124)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 89; E-Value: 7e-43
Query Start/End: Original strand, 62 - 184
Target Start/End: Complemental strand, 19338309 - 19338190
Alignment:
| Q |
62 |
atatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgt |
161 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||| ||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
19338309 |
atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccgg---atgccatgaccggggttcgaaccccggtacctccacttgtgtgtgt |
19338213 |
T |
 |
| Q |
162 |
gagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||||| |||| |
|
|
| T |
19338212 |
gagtttataatggctttgccatt |
19338190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 63 - 184
Target Start/End: Original strand, 29005088 - 29005206
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| |||||||| ||||||||||| ||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
29005088 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccgg---atgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtg |
29005184 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
29005185 |
agtttataatggctttgccatt |
29005206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 64 - 184
Target Start/End: Complemental strand, 25821079 - 25820962
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| ||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25821079 |
atccagaagtcctagctcaactgataaaatgtcgaaattgttaggccgg---atgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
25820983 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
25820982 |
gtttataatggctttgccatt |
25820962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 62 - 184
Target Start/End: Complemental strand, 40958705 - 40958586
Alignment:
| Q |
62 |
atatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgt |
161 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||| ||||||||||||||||| ||||||||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
40958705 |
atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccgg---atgccatgaccggggttcgaatcccggtacctccacttgtgtgtgt |
40958609 |
T |
 |
| Q |
162 |
gagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||||| |||| |
|
|
| T |
40958608 |
gagtttataatggctttgccatt |
40958586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 64 - 184
Target Start/End: Complemental strand, 43676153 - 43676036
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| ||||||||||| ||||||||||||||||| |||||||||||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
43676153 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccgg---atgccatgaccggggttcgaaccccggtaccttcacttgtgtgtgtga |
43676057 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
43676056 |
gtttataatggctttgccatt |
43676036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 62 - 184
Target Start/End: Original strand, 10635486 - 10635606
Alignment:
| Q |
62 |
atatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgt |
161 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||| ||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
10635486 |
atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccgg---atgccatgaccggggttcgaaccccggtacctccacttgtgtgtgt |
10635582 |
T |
 |
| Q |
162 |
gag-tttataatggctttggcatt |
184 |
Q |
| |
|
||| ||||||||||||||| |||| |
|
|
| T |
10635583 |
gagttttataatggctttgccatt |
10635606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 61 - 184
Target Start/End: Original strand, 48391952 - 48392072
Alignment:
| Q |
61 |
tatatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtg |
160 |
Q |
| |
|
||||||||||||| |||||||| ||||||||||| ||||||||||||||||| ||||||||||| |||||||||||| ||||||||||||| |||||| |
|
|
| T |
48391952 |
tatatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccgg---atgccatgaccagggttcgaaccccggtacctccacttatgtgtg |
48392048 |
T |
 |
| Q |
161 |
tgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||||| |||| |
|
|
| T |
48392049 |
tgagtttataatggctttgccatt |
48392072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 75 - 184
Target Start/End: Complemental strand, 20164191 - 20164085
Alignment:
| Q |
75 |
ctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatgg |
174 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
20164191 |
ctagctcaactggcaaaatgccgaaattgttaggccgg---atgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataatgg |
20164095 |
T |
 |
| Q |
175 |
ctttggcatt |
184 |
Q |
| |
|
||||| |||| |
|
|
| T |
20164094 |
ctttgccatt |
20164085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 79; E-Value: 7e-37
Query Start/End: Original strand, 64 - 184
Target Start/End: Complemental strand, 43086600 - 43086483
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
||||| |||| |||||||| ||||||||||| ||||||||||||||||| ||||||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
43086600 |
atccataagtcctagctcaactggcaaaatgccgaaattgttaggccgg---atgccatgatcggggttcgaaccccggtacctccacttgtgtgtgtga |
43086504 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
43086503 |
gtttataatggctttgtcatt |
43086483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 79; E-Value: 7e-37
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 49948240 - 49948357
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||||||||||||||| |||||||||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
49948240 |
atccagaagtcctagctcaactggcaaaatgtcgaaattgttaggccgg---atgccatgaccgggattcgaaccccagtacctccacttgtgtgtgtga |
49948336 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||| ||||| |||| |
|
|
| T |
49948337 |
gtttataatgactttgtcatt |
49948357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 64 - 178
Target Start/End: Original strand, 48314166 - 48314277
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| ||||||||||| ||||||||||||||||| ||| |||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
48314166 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccgg---atgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtga |
48314262 |
T |
 |
| Q |
164 |
gtttataatggcttt |
178 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
48314263 |
atttataatggcttt |
48314277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 63 - 184
Target Start/End: Original strand, 17068150 - 17068268
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| |||||||| |||| |||||| ||||||||||||||||| ||||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
17068150 |
tatccagaagtcctagctcaactggtaaaatgccgaaattgttaggccgg---atgccatgagcggggttcgaaccccggtacctccacttgtgtgtgtg |
17068246 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||| |||| |||| |
|
|
| T |
17068247 |
agtttataatggttttgtcatt |
17068268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 63 - 184
Target Start/End: Original strand, 34010092 - 34010210
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||||||||||||||||| ||||||||| ||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
34010092 |
tatccagaagtcttagctcaactggcaaaatgtcgaaattgttaggccgg---atgccatgatcggggtttgaaccccggtacctccacttgtgtgtgtg |
34010188 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||| |||| |||| |
|
|
| T |
34010189 |
agtttataatggttttgccatt |
34010210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 63 - 184
Target Start/End: Complemental strand, 42631115 - 42630997
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| |||||||| ||||||||||| ||||||||||||||||| ||||||||| |||||||||||||| | |||||||||||||||||||| |
|
|
| T |
42631115 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccgg---atgccatgatcggggttcgaaccccgatacctccacttgtgtgtgtg |
42631019 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||| ||||| |||| |
|
|
| T |
42631018 |
agtttataatgactttgtcatt |
42630997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 62 - 184
Target Start/End: Complemental strand, 32880710 - 32880591
Alignment:
| Q |
62 |
atatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgt |
161 |
Q |
| |
|
||||| |||||| ||| |||| ||||||||||| ||||||||||||||||| |||||||||| ||||||||||||| | ||||||||||||||||||| |
|
|
| T |
32880710 |
atatctagaagtcctaactcaactggcaaaatgccgaaattgttaggccgg---atgccatgactggggttcgaaccccgctacctccacttgtgtgtgt |
32880614 |
T |
 |
| Q |
162 |
gagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||||| |||| |
|
|
| T |
32880613 |
gagtttataatggctttgtcatt |
32880591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 67 - 184
Target Start/End: Original strand, 24119658 - 24119772
Alignment:
| Q |
67 |
cagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtt |
166 |
Q |
| |
|
||||||| |||||||| ||||||||||| ||||||||||||||||| ||| ||||||||||||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
24119658 |
cagaagtcctagctcaactggcaaaatgccgaaattgttaggccgg---atgtcatgaccggggttcgaaccctggtatctccacttatgtgtgtgagtt |
24119754 |
T |
 |
| Q |
167 |
tataatggctttggcatt |
184 |
Q |
| |
|
|||||| |||||| |||| |
|
|
| T |
24119755 |
tataatagctttgccatt |
24119772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 63 - 184
Target Start/End: Original strand, 50248027 - 50248145
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| |||||||| ||| |||||||||||||||||||||||| ||| |||||||| ||||||||||| | |||||||||||||||||||| |
|
|
| T |
50248027 |
tatccagaagtcctagctcaactgataaaatgtcgaaattgttaggccgg---atgtcatgaccgaggttcgaaccccgatacctccacttgtgtgtgtg |
50248123 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
50248124 |
agtttataatggctttgccatt |
50248145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 52 - 184
Target Start/End: Original strand, 4126562 - 4126691
Alignment:
| Q |
52 |
taattaatttatatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccac |
151 |
Q |
| |
|
|||||||| | ||||||||||| |||||||| ||| ||||||| |||||||||||||||| ||||||||| | |||||||||||| ||||||||||| |
|
|
| T |
4126562 |
taattaatatgtatccagaagtcctagctcaactgacaaaatgcggaaattgttaggccgg---atgccatgatcagggttcgaaccccggtacctccac |
4126658 |
T |
 |
| Q |
152 |
ttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||| |
|
|
| T |
4126659 |
ttgtgtgtgtgagtttataatgcctttgccatt |
4126691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 5598300 - 5598417
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| |||| |||||| ||||||||||||| ||| ||| ||||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
5598300 |
atccagaagtcctagctcaactggaaaaatgccgaaattgttaggtcgg---atgtcatgaccggagttcgaaccccggtacctccacttgtgtgtgtga |
5598396 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
5598397 |
gtttataatggctttgtcatt |
5598417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 36586250 - 36586367
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
||||| |||| ||| |||| |||| |||||||||||||||||||||||| ||||| ||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
36586250 |
atccacaagtcctaactcaactggtaaaatgtcgaaattgttaggccgg---atgccgtgatcggggttcgaaccccggtacctccacttgtgtgtgtga |
36586346 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
36586347 |
gtttataatggctttgtcatt |
36586367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 68 - 184
Target Start/End: Complemental strand, 48731881 - 48731768
Alignment:
| Q |
68 |
agaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagttt |
167 |
Q |
| |
|
|||||| |||||||| ||| ||||||| ||||||||||||||| | |||||||||||||||||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
48731881 |
agaagtcctagctcaactgacaaaatgccgaaattgttaggccag---atgccatgaccggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
48731785 |
T |
 |
| Q |
168 |
ataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||| |||| |
|
|
| T |
48731784 |
ataatggctttgtcatt |
48731768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 64 - 184
Target Start/End: Complemental strand, 270451 - 270335
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaa-tgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
|||||||||| |||||||| ||||||||| || ||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
270451 |
atccagaagtcctagctcaactggcaaaaatgccgaaattgttaggccgg---atgccatgaccggggttcgaaccccggtacctccacttgtg--tgtg |
270357 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
270356 |
agtttataatggctttgccatt |
270335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 67 - 184
Target Start/End: Original strand, 3315796 - 3315910
Alignment:
| Q |
67 |
cagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtt |
166 |
Q |
| |
|
||||||| |||||||| ||||||||||| ||| ||||||||||||| ||||||||||| || ||||||||| |||||||||||||||||||||||||| |
|
|
| T |
3315796 |
cagaagtcctagctcaactggcaaaatgccgacattgttaggccgg---atgccatgaccaggattcgaaccccggtacctccacttgtgtgtgtgagtt |
3315892 |
T |
 |
| Q |
167 |
tataatggctttggcatt |
184 |
Q |
| |
|
|||||| |||||| |||| |
|
|
| T |
3315893 |
tataattgctttgccatt |
3315910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 68 - 184
Target Start/End: Complemental strand, 13555849 - 13555735
Alignment:
| Q |
68 |
agaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgag-tt |
166 |
Q |
| |
|
|||||| |||||||| ||||||||||| ||||||| ||||||||| ||| |||||||||||||||||||| |||||||||||||||||||||||| || |
|
|
| T |
13555849 |
agaagtcctagctcaactggcaaaatgccgaaattattaggccgg---atgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
13555753 |
T |
 |
| Q |
167 |
tataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||| |||| |
|
|
| T |
13555752 |
tataatggctttgccatt |
13555735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 68 - 184
Target Start/End: Original strand, 39606407 - 39606521
Alignment:
| Q |
68 |
agaagttctagctcagctggcaaaa-tgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtt |
166 |
Q |
| |
|
|||||| |||||||| ||||||||| || ||| ||||||||||||| |||||||||||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
39606407 |
agaagtcctagctcaactggcaaaaatgccgatattgttaggccgg---atgccatgaccggggttcgaaccccgatacctccacttgtgtgtgtgagtt |
39606503 |
T |
 |
| Q |
167 |
tataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||| |||| |
|
|
| T |
39606504 |
tataatggctttgccatt |
39606521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 63 - 184
Target Start/End: Original strand, 40685527 - 40685645
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||||||||||| ||| ||| |||||||||||||||||| | | |||||||| ||||||||| | |
|
|
| T |
40685527 |
tatccagaagtcctagctcaactggcaaaatgtcgaaattgttaggtcgg---atgtcatgaccggggttcgaactccgatacctccatttgtgtgtgag |
40685623 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
40685624 |
agtttataatggctttgccatt |
40685645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 62 - 178
Target Start/End: Complemental strand, 15906298 - 15906185
Alignment:
| Q |
62 |
atatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgt |
161 |
Q |
| |
|
|||||||||||| |||||||| || |||||||| ||||||||||||||| | ||||||||| | |||||||||||| ||||||||||||| ||||||| |
|
|
| T |
15906298 |
atatccagaagtcctagctcaactagcaaaatgccgaaattgttaggccag---atgccatgatcagggttcgaaccccggtacctccacttatgtgtgt |
15906202 |
T |
 |
| Q |
162 |
gagtttataatggcttt |
178 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
15906201 |
gagtttataatggcttt |
15906185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 27078548 - 27078664
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||| |||||||||| ||| ||||||||||||||||||||||||| ||| |||||||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
27078548 |
atccagaaattctagctcaactg-caaaatgtcgaaattgttaggccgg---atgtcatgaccggggttcgaaccccggtacctccacttatgtgtgtga |
27078643 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||| |||| |||| |||| |
|
|
| T |
27078644 |
gtttatgatggttttgccatt |
27078664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 49500860 - 49500977
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
||||| |||| |||||||| ||||||||||| ||||||||||||||||| ||| ||||| || ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
49500860 |
atccacaagtcctagctcaactggcaaaatgccgaaattgttaggccgg---atgtcatgatcgaggttcgaaccccggtacctccacttgtgtgtgtga |
49500956 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||| |||||| |||| |
|
|
| T |
49500957 |
gtttataatagctttgtcatt |
49500977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 63 - 178
Target Start/End: Original strand, 21522315 - 21522427
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
|||| |||||| |||||||| ||||||| || ||||||||||||| ||| |||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
21522315 |
tatctagaagtcctagctcaattggcaaagtgccgaaattgttaggtcgg---atgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtg |
21522411 |
T |
 |
| Q |
163 |
agtttataatggcttt |
178 |
Q |
| |
|
|||||||||| ||||| |
|
|
| T |
21522412 |
agtttataattgcttt |
21522427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 73 - 184
Target Start/End: Complemental strand, 33845724 - 33845616
Alignment:
| Q |
73 |
ttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataat |
172 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||| |||| ||| ||||||||| |||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
33845724 |
ttctagctcaactggcaaaatgccgaaattgttagaccgg---atgtcatgaccggagttcgaaccccggtacctccaattgtgtgtgtgagtttataat |
33845628 |
T |
 |
| Q |
173 |
ggctttggcatt |
184 |
Q |
| |
|
||||||| |||| |
|
|
| T |
33845627 |
ggctttgccatt |
33845616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 73 - 184
Target Start/End: Original strand, 33948254 - 33948362
Alignment:
| Q |
73 |
ttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataat |
172 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||| |||| ||| ||||||||| |||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
33948254 |
ttctagctcaactggcaaaatgccgaaattgttagaccgg---atgtcatgaccggagttcgaaccccggtacctccaattgtgtgtgtgagtttataat |
33948350 |
T |
 |
| Q |
173 |
ggctttggcatt |
184 |
Q |
| |
|
||||||| |||| |
|
|
| T |
33948351 |
ggctttgccatt |
33948362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 62 - 184
Target Start/End: Original strand, 13018070 - 13018189
Alignment:
| Q |
62 |
atatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgt |
161 |
Q |
| |
|
||||| |||||| ||||||| |||||||| || |||||||||||| |||| |||||||||||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
13018070 |
atatcaagaagtcttagctcaactggcaaagtgccgaaattgttagaccgg---atgccatgaccggggttcgaaccccggtacctccacttgtatgtgt |
13018166 |
T |
 |
| Q |
162 |
gagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
13018167 |
cagtttataatggctttgtcatt |
13018189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 60 - 184
Target Start/End: Complemental strand, 10430473 - 10430351
Alignment:
| Q |
60 |
ttatatccagaagttctagctcagctggcaaaa-tgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtg |
158 |
Q |
| |
|
||||||| | |||| |||||||| ||| ||||| || ||||||||||||||||| |||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
10430473 |
ttatatcgacaagtcctagctcaactgacaaaaatgccgaaattgttaggccgg---atgcaatgactggggttcgaaccctggtacctccacttgtgtg |
10430377 |
T |
 |
| Q |
159 |
tgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||| ||||| |||| |
|
|
| T |
10430376 |
tgtgagtttataatgcctttgccatt |
10430351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 67 - 184
Target Start/End: Complemental strand, 41445156 - 41445042
Alignment:
| Q |
67 |
cagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtt |
166 |
Q |
| |
|
||||||| |||||||| ||||||||||| ||| ||||||||||||| ||| ||||| ||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
41445156 |
cagaagtcctagctcaactggcaaaatgccgacattgttaggccgg---atgtcatgatcggagttcgaaccccggtacctccacttgtgtgtgtgagtt |
41445060 |
T |
 |
| Q |
167 |
tataatggctttggcatt |
184 |
Q |
| |
|
||| ||||||||| |||| |
|
|
| T |
41445059 |
tattatggctttgccatt |
41445042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 64 - 184
Target Start/End: Complemental strand, 18089897 - 18089781
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| ||| ||| ||| ||||||| ||||||||||||||||| ||| |||||||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
18089897 |
atccagaagtcttagttcaactgacaaaatgccgaaattgttaggccgg---atgtcatgaccggggttcgaaccccggtacctccacttgtgt-tgtga |
18089802 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
18089801 |
gtttataatggctttgccatt |
18089781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 64 - 179
Target Start/End: Complemental strand, 40809342 - 40809235
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| ||||||||||| ||||||||||||||||| ||| |||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
40809342 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccgg---atgtcatgaccggggt-----ccccggtacctccacttgtgtgtgtga |
40809251 |
T |
 |
| Q |
164 |
gtttataatggctttg |
179 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
40809250 |
gtttataatggctttg |
40809235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 70 - 184
Target Start/End: Complemental strand, 15331185 - 15331074
Alignment:
| Q |
70 |
aagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttat |
169 |
Q |
| |
|
|||| |||||||| |||| |||||| ||||||||||||| ||| |||||||||||| ||||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
15331185 |
aagtcctagctcaactggaaaaatgccgaaattgttaggtcgg---atgccatgaccgaggttcgaaccccggtacctccacttgtgtatgtgagtttat |
15331089 |
T |
 |
| Q |
170 |
aatggctttggcatt |
184 |
Q |
| |
|
|||| ||||| |||| |
|
|
| T |
15331088 |
aatgactttgtcatt |
15331074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 67 - 184
Target Start/End: Original strand, 11403171 - 11403285
Alignment:
| Q |
67 |
cagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtt |
166 |
Q |
| |
|
||||||| |||||||| |||| |||||| ||||||||||||| ||| ||||||||| |||||||||||||| ||||| |||| ||||||||||||||| |
|
|
| T |
11403171 |
cagaagtcctagctcaactgggaaaatgccgaaattgttaggtcgg---atgccatgatcggggttcgaaccccggtacatccatttgtgtgtgtgagtt |
11403267 |
T |
 |
| Q |
167 |
tataatggctttggcatt |
184 |
Q |
| |
|
|||||| |||||| |||| |
|
|
| T |
11403268 |
tataatagctttgtcatt |
11403285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 67 - 184
Target Start/End: Original strand, 18216346 - 18216460
Alignment:
| Q |
67 |
cagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtt |
166 |
Q |
| |
|
||||||| |||||||| || |||||| ||||||||||||||||| ||||||||| |||||||| ||| | |||||||||||||||||||||||||| |
|
|
| T |
18216346 |
cagaagtcctagctcaatgggtaaaatgccgaaattgttaggccgg---atgccatgatcggggttcaaactccggtacctccacttgtgtgtgtgagtt |
18216442 |
T |
 |
| Q |
167 |
tataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||| |||| |
|
|
| T |
18216443 |
tataatggctttgccatt |
18216460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 64 - 184
Target Start/End: Complemental strand, 23225420 - 23225302
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaa-tgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||| |||| |||||||| |||| |||| |||| ||||||||||| ||| |||||||||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
23225420 |
atccacaagtcctagctcaactggtaaaaatgtcaaaattgttaggtcgg---atgccatgacaggggttcgaaccccggtacctccacttgtgtgtgtg |
23225324 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||| |||| |||| |
|
|
| T |
23225323 |
agtttataatggttttgccatt |
23225302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 58 - 179
Target Start/End: Complemental strand, 39787785 - 39787667
Alignment:
| Q |
58 |
atttatatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgt |
157 |
Q |
| |
|
|||| |||||| |||| |||||||| |||| ||||||||||||||||||| ||| |||||||||||||||||||||| | ||||||||||||| | | |
|
|
| T |
39787785 |
atttttatccacaagtcctagctcaactggtaaaatgtcgaaattgttagaccga---atgccatgaccggggttcgaactccggtacctccacttatat |
39787689 |
T |
 |
| Q |
158 |
gtgtgagtttataatggctttg |
179 |
Q |
| |
|
|||||||||||||||| ||||| |
|
|
| T |
39787688 |
gtgtgagtttataatgactttg |
39787667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 87 - 184
Target Start/End: Complemental strand, 47429698 - 47429604
Alignment:
| Q |
87 |
gcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||| ||||||||||||||||| ||||||||| ||||||||||| || ||||||||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
47429698 |
gcaaaatgccgaaattgttaggccgg---atgccatgatcggggttcgaatcccggtacctccacttatgtgtgtgagtttataatggctttgtcatt |
47429604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 60 - 184
Target Start/End: Original strand, 15104039 - 15104160
Alignment:
| Q |
60 |
ttatatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgt |
159 |
Q |
| |
|
||||||| |||||| |||||||| ||| ||||||| | ||||||||||||||| ||| ||||| |||||||||||||| | |||||| |||| ||||| |
|
|
| T |
15104039 |
ttatatctagaagtcctagctcaactgacaaaatgccaaaattgttaggccgg---atgtcatgatcggggttcgaaccccgatacctctacttatgtgt |
15104135 |
T |
 |
| Q |
160 |
gtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||||||| |||| |
|
|
| T |
15104136 |
gtgagtttataatggctttgccatt |
15104160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 63 - 184
Target Start/End: Complemental strand, 25083249 - 25083132
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgt- |
161 |
Q |
| |
|
||||||||||| |||||||| ||||||||||| |||||||| | |||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
25083249 |
tatccagaagtcctagctcaactggcaaaatgctgaaattgt------gccggatgccatgatcggggttcgaaccccggtacctccacttgtgtgtgtg |
25083156 |
T |
 |
| Q |
162 |
-gagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||||| |||| |
|
|
| T |
25083155 |
agagtttataatggctttgtcatt |
25083132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 114 - 179
Target Start/End: Complemental strand, 52155340 - 52155275
Alignment:
| Q |
114 |
ggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttg |
179 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52155340 |
ggatgccatgaccggggttcgaaccccagtacctccacttgtgtgtgtgagtttataatggctttg |
52155275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 91 - 184
Target Start/End: Complemental strand, 29803275 - 29803185
Alignment:
| Q |
91 |
aatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||| ||||||||||||||| | ||||||||| |||||||||||||| ||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
29803275 |
aatgccgaaattgttaggccag---atgccatgatcggggttcgaaccccggtacatccacttgtgtgtgtgagtttataatggctttgccatt |
29803185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 63 - 172
Target Start/End: Original strand, 32533825 - 32533931
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||| | |||||||||||||| ||||||| | ||| |||||||| ||||||||||||||| |||||||| |
|
|
| T |
32533825 |
tatccagaagttctagttcaactggcaaaatgccaaaattgttaggccga---atgccataatcggagttcgaactctggtacctccacttatgtgtgtg |
32533921 |
T |
 |
| Q |
163 |
agtttataat |
172 |
Q |
| |
|
|||||||||| |
|
|
| T |
32533922 |
agtttataat |
32533931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 115 - 178
Target Start/End: Original strand, 35758322 - 35758385
Alignment:
| Q |
115 |
gatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggcttt |
178 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
35758322 |
gatgccatgaccggggttcgaaccccggtacctccacttatgtgtgtgagtttataatggcttt |
35758385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 64 - 177
Target Start/End: Original strand, 40503596 - 40503706
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
||||||||||||||||||| ||| |||||||| ||||||||||||| |||||| ||||| | |||||||| ||||||| |||||||| ||||||||| |
|
|
| T |
40503596 |
atccagaagttctagctcaactgacaaaatgttgaaattgttaggc---cggatgtcatgatcaaggttcgaatcctggtaactccacttatgtgtgtga |
40503692 |
T |
 |
| Q |
164 |
gtttataatggctt |
177 |
Q |
| |
|
|| ||||||||||| |
|
|
| T |
40503693 |
gtatataatggctt |
40503706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 88 - 184
Target Start/End: Original strand, 36018901 - 36018994
Alignment:
| Q |
88 |
caaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||||||||||| ||| ||||| |||||||| || |||| ||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
36018901 |
caaaatgtcgaaattgttaggccgg---atgtcatgatcggggttcaaatcctgatacttccacttgtgtgtgtgagtttataatggctttgccatt |
36018994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 76 - 184
Target Start/End: Complemental strand, 43500260 - 43500155
Alignment:
| Q |
76 |
tagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggc |
175 |
Q |
| |
|
||||||| |||| |||||||||||||||||||| ||| |||| |||| |||||||| ||| |||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
43500260 |
tagctcaactggtaaaatgtcgaaattgttaggtcgg---atgctatgatcggggttcaaactctggtacctccatttgtgtatgtgagtttataatggc |
43500164 |
T |
 |
| Q |
176 |
tttggcatt |
184 |
Q |
| |
|
|||| |||| |
|
|
| T |
43500163 |
tttgccatt |
43500155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 65 - 184
Target Start/End: Original strand, 2112747 - 2112863
Alignment:
| Q |
65 |
tccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgag |
164 |
Q |
| |
|
|||| |||| |||||||| || |||||||| ||||| |||||| ||| | | |||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2112747 |
tccacaagtcctagctcaactagcaaaatgatgaaatcgttaggtcgg---acgtcatgaccggggttcgaacccatgtacctccacttgtgtgtgtgag |
2112843 |
T |
 |
| Q |
165 |
tttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||| |||| |
|
|
| T |
2112844 |
tttataatggctttgtcatt |
2112863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 61 - 184
Target Start/End: Complemental strand, 19279984 - 19279864
Alignment:
| Q |
61 |
tatatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtg |
160 |
Q |
| |
|
||||||||||||| |||||||| |||| |||||| ||||||||||||| ||| || |||||| ||||| ||||||||||| |||||||| ||||| |
|
|
| T |
19279984 |
tatatccagaagtcctagctcaactggtaaaatgccgaaattgttaggtcgg---ataccatgattagggtttgaaccctggtatctccacttatgtgta |
19279888 |
T |
 |
| Q |
161 |
tgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||||| |||| |
|
|
| T |
19279887 |
tgagtttataatggctttgtcatt |
19279864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 64 - 179
Target Start/End: Complemental strand, 26261422 - 26261310
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
||||| |||| |||||||| |||| |||||| ||||||||||||||||| || |||||| ||||||||||| || ||||||||||||||||||||| | |
|
|
| T |
26261422 |
atccacaagtcctagctcaactggaaaaatgccgaaattgttaggccgg---ataccatgatcggggttcgaatcccggtacctccacttgtgtgtgtaa |
26261326 |
T |
 |
| Q |
164 |
gtttataatggctttg |
179 |
Q |
| |
|
||||||||| ||||| |
|
|
| T |
26261325 |
atttataatgtctttg |
26261310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 63 - 178
Target Start/End: Complemental strand, 29510781 - 29510669
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| ||| |||| ||| ||||||| | |||||||||| |||||| ||||||||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
29510781 |
tatccagaagtcctaactcaactgtcaaaatgccaaaattgttag---atcggatgtcatgaccggggttcgaaccttggtacttccacttgtgtgtgtg |
29510685 |
T |
 |
| Q |
163 |
agtttataatggcttt |
178 |
Q |
| |
|
||||||||||| |||| |
|
|
| T |
29510684 |
agtttataatgacttt |
29510669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 63 - 184
Target Start/End: Original strand, 18475107 - 18475222
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| |||||||| |||||||||| ||| |||||||||| |||||||||||| ||||||||||||||||||||| ||| | ||||||| |
|
|
| T |
18475107 |
tatccagaagtcctagctcaactggcaaaataccgacattgttaggc---cggatgccatgatcggggttcgaaccctggtacc-cca--tatgtgtgta |
18475200 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
18475201 |
agtttataatggctttgccatt |
18475222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 67 - 184
Target Start/End: Complemental strand, 8194088 - 8193974
Alignment:
| Q |
67 |
cagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtt |
166 |
Q |
| |
|
||||||| |||||| | ||| ||||| ||||||||||||||| | |||||||||||||||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
8194088 |
cagaagtcctagcttaactgataaaataccgaaattgttaggcctg---atgccatgaccggggttcgaacccctgtacctccacttatgtgtgtgagtt |
8193992 |
T |
 |
| Q |
167 |
tataatggctttggcatt |
184 |
Q |
| |
|
||||||| ||||| |||| |
|
|
| T |
8193991 |
tataatgactttgccatt |
8193974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 63 - 184
Target Start/End: Original strand, 12282613 - 12282730
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
|||| |||||| |||| ||| ||| ||| ||||||||||||||||| || |||||||||||||||||||||| | ||||||||||||| ||||||| |
|
|
| T |
12282613 |
tatctagaagtcctagttcaactgataaagtgtcgaaattgttaggctgg---atgccatgaccggggttcgaactc-ggtacctccacttatgtgtgta |
12282708 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
12282709 |
agtttataatggctttgccatt |
12282730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 64 - 173
Target Start/End: Complemental strand, 46561364 - 46561258
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
||||||||||||||| ||| || |||||||| | |||||||||| |||| ||||||||| |||||||||||| | | |||||||||||| |||||||| |
|
|
| T |
46561364 |
atccagaagttctagttcaactagcaaaatgccaaaattgttagtccgg---atgccatgatcggggttcgaactccgttacctccacttgcgtgtgtga |
46561268 |
T |
 |
| Q |
164 |
gtttataatg |
173 |
Q |
| |
|
|||||||||| |
|
|
| T |
46561267 |
gtttataatg |
46561258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 67 - 179
Target Start/End: Complemental strand, 40962828 - 40962719
Alignment:
| Q |
67 |
cagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtt |
166 |
Q |
| |
|
||||||| |||||||| ||| ||||||| | ||||| |||||| || ||||||||| |||||||||||||| | ||||||||||| |||||||||||| |
|
|
| T |
40962828 |
cagaagtcctagctcaactgacaaaatgccaaaattattaggctgg---atgccatgatcggggttcgaaccccgatacctccacttatgtgtgtgagtt |
40962732 |
T |
 |
| Q |
167 |
tataatggctttg |
179 |
Q |
| |
|
|||||||| |||| |
|
|
| T |
40962731 |
tataatggttttg |
40962719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 64 - 179
Target Start/End: Original strand, 5322591 - 5322703
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
||||||||||||||||||| ||| ||||||| ||||||||||||| || || |||||||||||||||||||| | ||| | ||||||||||||| | |
|
|
| T |
5322591 |
atccagaagttctagctcaactgacaaaatgctgaaattgttaggctgg---atatcatgaccggggttcgaaccccgatacgttcacttgtgtgtgtaa |
5322687 |
T |
 |
| Q |
164 |
gtttataatggctttg |
179 |
Q |
| |
|
|| ||||||||||||| |
|
|
| T |
5322688 |
gtgtataatggctttg |
5322703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 64 - 178
Target Start/End: Original strand, 8214622 - 8214731
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| |||| ||||| |||||||||||||||||| | ||||||||||||||| ||||| | ||||||||| |||||| ||| |
|
|
| T |
8214622 |
atccagaagtcctagctcaactggaaaaatatcgaaattgttaggccgg---accccatgaccggggttcaaaccccgatacctccac--gtgtgtatga |
8214716 |
T |
 |
| Q |
164 |
gtttataatggcttt |
178 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
8214717 |
gtttataatggcttt |
8214731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 85 - 184
Target Start/End: Complemental strand, 13980414 - 13980318
Alignment:
| Q |
85 |
tggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||||||||||| ||| || ||||| ||||||||||| || ||||||||||||| |||||||||||||||||| |||||| |||| |
|
|
| T |
13980414 |
tggcaaaatgtcgaaattgttaggtcgg---atatcatgatcggggttcgaatcccggtacctccacttatgtgtgtgagtttataatagctttgccatt |
13980318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 62 - 184
Target Start/End: Original strand, 43025883 - 43026007
Alignment:
| Q |
62 |
atatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccac-----ttgtg |
156 |
Q |
| |
|
|||||||||||| |||| ||| ||| |||||| ||||||||||||||| |||||||||||||| |||||||||| |||||||||| ||||| |
|
|
| T |
43025883 |
atatccagaagtcctagttcaactgacaaaatatcgaaattgttaggc---cggatgccatgacctgggttcgaacttcagtacctccacttgtgttgtg |
43025979 |
T |
 |
| Q |
157 |
tgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||||||||| |||| |
|
|
| T |
43025980 |
tgtgtgagtttataatggctttgccatt |
43026007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 62 - 184
Target Start/End: Complemental strand, 45007822 - 45007704
Alignment:
| Q |
62 |
atatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgt |
161 |
Q |
| |
|
||||||| || | |||||||| ||| ||||| |||||||||||||||||| ||| |||||||| ||||||||||| |||||||| ||| ||||||| |
|
|
| T |
45007822 |
atatccaaaaatcctagctcaattggtaaaatatcgaaattgttaggccgg---atgtcatgaccgaggttcgaaccccagtacctcc-cttatgtgtgt |
45007727 |
T |
 |
| Q |
162 |
gagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||||| |||| |
|
|
| T |
45007726 |
gagtttataatggctttgtcatt |
45007704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 113 - 184
Target Start/End: Original strand, 1576419 - 1576490
Alignment:
| Q |
113 |
cggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||||||||||| | | ||||||||||| |||||||||||||||||||| |||| |||| |
|
|
| T |
1576419 |
cggatgccatgaccggggttcgaactccgttacctccacttatgtgtgtgagtttataatggttttgtcatt |
1576490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 11786102 - 11786220
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
||||| ||||||||||||| ||| |||||| |||||||||||||||| ||| |||| | ||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
11786102 |
atccacaagttctagctcaactgataaaatgctgaaattgttaggccgg---atgtcatggctggggttcaaaccccggtacctccacttgtgtgtgtga |
11786198 |
T |
 |
| Q |
164 |
g-tttataatggctttggcatt |
184 |
Q |
| |
|
| ||||||||| ||||| |||| |
|
|
| T |
11786199 |
gttttataatgactttgtcatt |
11786220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 70 - 167
Target Start/End: Complemental strand, 11797522 - 11797428
Alignment:
| Q |
70 |
aagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagttt |
167 |
Q |
| |
|
|||| ||| |||| |||||||||||||||||||||||||||| ||| |||||||||| ||||||| |||||||||||||| ||||||||||||| |
|
|
| T |
11797522 |
aagtcctaactcaactggcaaaatgtcgaaattgttaggccga---atgtcatgaccgggattcgaacattggtacctccacttatgtgtgtgagttt |
11797428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 75 - 184
Target Start/End: Complemental strand, 13048925 - 13048819
Alignment:
| Q |
75 |
ctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatgg |
174 |
Q |
| |
|
|||| ||| |||| ||||| |||||||||||||||||| ||| ||||| ||| |||||||||| |||||||||| || |||||||||||||||||||| |
|
|
| T |
13048925 |
ctagttcaactggtaaaatatcgaaattgttaggccgg---atgtcatgatcggagttcgaaccccggtacctccatttatgtgtgtgagtttataatgg |
13048829 |
T |
 |
| Q |
175 |
ctttggcatt |
184 |
Q |
| |
|
|||| |||| |
|
|
| T |
13048828 |
ttttgccatt |
13048819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 75 - 184
Target Start/End: Complemental strand, 13053922 - 13053816
Alignment:
| Q |
75 |
ctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatgg |
174 |
Q |
| |
|
|||| ||| |||| ||||| |||||||||||||||||| ||| ||||| ||| |||||||||| |||||||||| || |||||||||||||||||||| |
|
|
| T |
13053922 |
ctagttcaactggtaaaatatcgaaattgttaggccgg---atgtcatgatcggagttcgaaccccggtacctccatttatgtgtgtgagtttataatgg |
13053826 |
T |
 |
| Q |
175 |
ctttggcatt |
184 |
Q |
| |
|
|||| |||| |
|
|
| T |
13053825 |
ttttgccatt |
13053816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 67 - 184
Target Start/End: Complemental strand, 39522884 - 39522770
Alignment:
| Q |
67 |
cagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtt |
166 |
Q |
| |
|
||||||| ||| |||| ||||||||||| |||||||||||||||| ||||||| | |||||||||||| | ||||| ||||| ||||| |||||||| |
|
|
| T |
39522884 |
cagaagtcctaactcaactggcaaaatgcagaaattgttaggccgg---atgccattatcggggttcgaactccggtacatccacctgtgtatgtgagtt |
39522788 |
T |
 |
| Q |
167 |
tataatggctttggcatt |
184 |
Q |
| |
|
|||||||| |||| |||| |
|
|
| T |
39522787 |
tataatggttttgccatt |
39522770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 116 - 178
Target Start/End: Original strand, 45788671 - 45788733
Alignment:
| Q |
116 |
atgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggcttt |
178 |
Q |
| |
|
||||||||| |||||||||||||| | ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
45788671 |
atgccatgatcggggttcgaaccccgatacctccacttctgtgtgtgagtttataatggcttt |
45788733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 89 - 173
Target Start/End: Original strand, 49632579 - 49632660
Alignment:
| Q |
89 |
aaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatg |
173 |
Q |
| |
|
|||||| |||||||||||||| || ||| |||||||| ||||||||||| | ||||||||||||||||||||||||||||||| |
|
|
| T |
49632579 |
aaaatgccgaaattgttaggctgg---atgtcatgaccgaggttcgaaccccgatacctccacttgtgtgtgtgagtttataatg |
49632660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 62 - 178
Target Start/End: Complemental strand, 52492812 - 52492699
Alignment:
| Q |
62 |
atatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgt |
161 |
Q |
| |
|
|||||| |||||||||||||| || ||||||| |||||||||||||||| ||| ||||| ||||||||||||| ||| || ||||||||||||| |
|
|
| T |
52492812 |
atatcctgaagttctagctcaattgataaaatgttgaaattgttaggccgg---atgtcatgattggggttcgaaccccggtttcttcacttgtgtgtgt |
52492716 |
T |
 |
| Q |
162 |
gagtttataatggcttt |
178 |
Q |
| |
|
|||||||||||| |||| |
|
|
| T |
52492715 |
gagtttataatgacttt |
52492699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 85 - 184
Target Start/End: Original strand, 9705547 - 9705642
Alignment:
| Q |
85 |
tggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||| | ||||||||||||||| |||||||||| ||||||||||||| ||| ||||||||||||||||||| |||||||| ||||| |||| |
|
|
| T |
9705547 |
tggcaaaatgccaaaattgttaggccgg---atgccatgactggggttcgaaccccggtttctccacttgtgtgtgtgag-ttataatgcctttgccatt |
9705642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 76 - 167
Target Start/End: Complemental strand, 15952949 - 15952861
Alignment:
| Q |
76 |
tagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagttt |
167 |
Q |
| |
|
||||||| ||||||||||| ||||||||||||| ||| ||| |||| |||||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
15952949 |
tagctcaactggcaaaatgccgaaattgttaggtcgg---atgttatgatcggggttcgaactccggtacctccacttgtgtgtgtgagttt |
15952861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 75 - 184
Target Start/End: Complemental strand, 21897799 - 21897695
Alignment:
| Q |
75 |
ctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatgg |
174 |
Q |
| |
|
|||||||| ||| |||||||||||||||||||||| |||||| |||| |||||||||||| | |||||||||||| ||| | |||||||||||||| |
|
|
| T |
21897799 |
ctagctcaactgacaaaatgtcgaaattgttaggc---tggatgctatgatcggggttcgaactccggtacctccact--tgtttatgagtttataatgg |
21897705 |
T |
 |
| Q |
175 |
ctttggcatt |
184 |
Q |
| |
|
||||| |||| |
|
|
| T |
21897704 |
ctttgccatt |
21897695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 76 - 178
Target Start/End: Original strand, 27856008 - 27856107
Alignment:
| Q |
76 |
tagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggc |
175 |
Q |
| |
|
||||||| |||| ||||| ||||||||||||||| | ||| ||||| ||||||||||| || ||||| ||||||||||||||||||||||||||| | |
|
|
| T |
27856008 |
tagctcaactggagaaatgccgaaattgttaggccag---atgtcatgatcggggttcgaatcccggtacttccacttgtgtgtgtgagtttataatgac |
27856104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #80
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 66 - 172
Target Start/End: Original strand, 29511109 - 29511212
Alignment:
| Q |
66 |
ccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagt |
165 |
Q |
| |
|
|||||||| |||||||| ||| |||||| |||||||||||||||| ||| |||||||||||||||||||| | |||||||| || ||||| ||||| |
|
|
| T |
29511109 |
ccagaagtcctagctcaattggtaaaatgacgaaattgttaggccga---atgtcatgaccggggttcgaaccccgatacctccatttatgtgtatgagt |
29511205 |
T |
 |
| Q |
166 |
ttataat |
172 |
Q |
| |
|
||||||| |
|
|
| T |
29511206 |
ttataat |
29511212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #81
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 113 - 184
Target Start/End: Original strand, 300961 - 301032
Alignment:
| Q |
113 |
cggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||| ||||||||||||| ||||| |||||| ||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
300961 |
cggatgctatgaccggggttcaaacccgagtaccttcacttgtatgtgtgagtttataatggctttgccatt |
301032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #82
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 68 - 157
Target Start/End: Original strand, 5790061 - 5790147
Alignment:
| Q |
68 |
agaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgt |
157 |
Q |
| |
|
|||||| |||||| | ||||||||||| |||||||||||||| |||||| ||||||||||||||||| || | ||||||||||||||| |
|
|
| T |
5790061 |
agaagtcctagcttaactggcaaaatgccgaaattgttaggc---cggatgtcatgaccggggttcgaatcccgatacctccacttgtgt |
5790147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #83
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 68 - 184
Target Start/End: Complemental strand, 50145258 - 50145144
Alignment:
| Q |
68 |
agaagttctagctcagctggcaaaa-tgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtt |
166 |
Q |
| |
|
|||||| |||||||| | ||||||| |||| | ||||||||||||| ||| |||||| ||| ||||||||| | ||||| |||||||||||||||||| |
|
|
| T |
50145258 |
agaagtcctagctcaaccggcaaaaatgtcaatattgttaggccgg---atgtcatgactgggattcgaaccccgataccttcacttgtgtgtgtgagtt |
50145162 |
T |
 |
| Q |
167 |
tataatggctttggcatt |
184 |
Q |
| |
|
||||||| ||||| |||| |
|
|
| T |
50145161 |
tataatgactttgtcatt |
50145144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #84
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 130 - 184
Target Start/End: Original strand, 6669368 - 6669422
Alignment:
| Q |
130 |
gttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
6669368 |
gttcgaaccccggtacctccacttatgtgtgtgagtttataatggctttgtcatt |
6669422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #85
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 68 - 184
Target Start/End: Original strand, 13948107 - 13948219
Alignment:
| Q |
68 |
agaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagttt |
167 |
Q |
| |
|
||||||||||||||| || | ||||| ||||||||||||| | | ||||| |||| |||||||||||||| || ||||||||||| ||||||||||| |
|
|
| T |
13948107 |
agaagttctagctcaactagtaaaatatcgaaattgttag---gtcagatgctatgatcggggttcgaaccccggcgcctccacttgt-tgtgtgagttt |
13948202 |
T |
 |
| Q |
168 |
ataatggctttggcatt |
184 |
Q |
| |
|
||||||| |||| |||| |
|
|
| T |
13948203 |
ataatggttttgtcatt |
13948219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #86
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 88 - 184
Target Start/End: Complemental strand, 23809989 - 23809896
Alignment:
| Q |
88 |
caaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||| |||||||||||||||||| ||| ||||| ||| |||||||| | | ||||||||||| ||||||||||||||||||| ||||| |||| |
|
|
| T |
23809989 |
caaaatatcgaaattgttaggccgg---atgtcatgatcggagttcgaactccgatacctccacttatgtgtgtgagtttataatgactttgtcatt |
23809896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #87
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 64 - 172
Target Start/End: Complemental strand, 35010718 - 35010613
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| || |||||||| |||||||||||||| ||||||||||| || |||||||||| | ||||||||||| | | ||||| |
|
|
| T |
35010718 |
atccagaagtcctagctcaactagcaaaatgccgaaattgttaggc---tggatgccatgattggagttcgaaccccgatacctccacttatatatgtga |
35010622 |
T |
 |
| Q |
164 |
gtttataat |
172 |
Q |
| |
|
||||||||| |
|
|
| T |
35010621 |
gtttataat |
35010613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #88
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 51263889 - 51263831
Alignment:
| Q |
120 |
catgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggcttt |
178 |
Q |
| |
|
|||||||||||||||||| | ||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
51263889 |
catgaccggggttcgaactccggtacctccacttatgtgtgtgagtttataatgacttt |
51263831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #89
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 127 - 184
Target Start/End: Complemental strand, 15324523 - 15324466
Alignment:
| Q |
127 |
ggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||| |||| |||| |||| |
|
|
| T |
15324523 |
ggggttcgaaccccggtacctccacttgtgtgtgtgagtttatgatggttttgccatt |
15324466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #90
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 70 - 179
Target Start/End: Complemental strand, 37186941 - 37186833
Alignment:
| Q |
70 |
aagttctagctcagctggcaaaa-tgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccac-ttgtgtgtgtgagttt |
167 |
Q |
| |
|
||||||||||||| |||| |||| || ||||||||||| ||||| | | ||||||| |||||||||| ||||||||||||| |||||||| ||||||| |
|
|
| T |
37186941 |
aagttctagctcaactggtaaaaatgccgaaattgttaagccgg---acgtcatgaccagggttcgaactctggtacctccactttgtgtgtttgagttt |
37186845 |
T |
 |
| Q |
168 |
ataatggctttg |
179 |
Q |
| |
|
|| ||||||||| |
|
|
| T |
37186844 |
atgatggctttg |
37186833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #91
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 89 - 179
Target Start/End: Original strand, 40241512 - 40241597
Alignment:
| Q |
89 |
aaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttg |
179 |
Q |
| |
|
|||||||||||||||||||||||| || ||||||||| ||||||||| |||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
40241512 |
aaaatgtcgaaattgttaggccgg---atatcatgaccggagttcgaacctcggtacctccact--tgtgtgtgagtttataatgactttg |
40241597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #92
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 89 - 179
Target Start/End: Original strand, 236594 - 236680
Alignment:
| Q |
89 |
aaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttg |
179 |
Q |
| |
|
|||||||||||||||||||||||| | | |||||||||||||||||||| ||||||| ||||| | ||||||||||||| ||| ||||| |
|
|
| T |
236594 |
aaaatgtcgaaattgttaggccgg---acgtcatgaccggggttcgaaccccggtaccttcactt-tatgtgtgagtttatgatgactttg |
236680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #93
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 70 - 184
Target Start/End: Original strand, 16689091 - 16689202
Alignment:
| Q |
70 |
aagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttat |
169 |
Q |
| |
|
|||| |||||||| |||||||||| |||||||| ||||| ||| | | | ||| |||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
16689091 |
aagtcctagctcaactggcaaaatatcgaaatttttaggtcgg---acgtcttgatcggggttcgaaccccaacacctcaacttgtgtgtgtgagtttat |
16689187 |
T |
 |
| Q |
170 |
aatggctttggcatt |
184 |
Q |
| |
|
|||||||||| |||| |
|
|
| T |
16689188 |
aatggctttgtcatt |
16689202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #94
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 120 - 184
Target Start/End: Complemental strand, 45566785 - 45566721
Alignment:
| Q |
120 |
catgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||| ||||||||| | ||||||||| |||||||||||||||||||||| ||||| |||| |
|
|
| T |
45566785 |
catgaccggagttcgaacctttgtacctccatttgtgtgtgtgagtttataatgactttgccatt |
45566721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #95
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 87 - 184
Target Start/End: Original strand, 46850986 - 46851078
Alignment:
| Q |
87 |
gcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||||||| | |||||||||| | |||| ||||||| |||||||||||||||||||| |||| |||| |
|
|
| T |
46850986 |
gcaaaatgtcgaaattgttaggtcgg---atgccatgatccgggttcgaactccggtatctccact--tgtgtgtgagtttataatggttttgccatt |
46851078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #96
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 8793251 - 8793192
Alignment:
| Q |
120 |
catgaccggggttcgaaccctggtacctccac-ttgtgtgtgtgagtttataatggcttt |
178 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| |||||||||||||||||| ||| |||| |
|
|
| T |
8793251 |
catgaccggggttcgaaccccggtacctccactttgtgtgtgtgagtttatgatgacttt |
8793192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #97
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 75 - 184
Target Start/End: Original strand, 11942541 - 11942647
Alignment:
| Q |
75 |
ctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatgg |
174 |
Q |
| |
|
|||||||| || | ||| ||||||||||||||||||| || | |||| |||||||||||| | |||| ||||||||||||||| ||||||||||||| |
|
|
| T |
11942541 |
ctagctcaactcgtaaagtgtcgaaattgttaggccga---atactatgatcggggttcgaactccggtatctccacttgtgtgtgagagtttataatgg |
11942637 |
T |
 |
| Q |
175 |
ctttggcatt |
184 |
Q |
| |
|
|||| |||| |
|
|
| T |
11942638 |
ttttgccatt |
11942647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #98
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 89 - 178
Target Start/End: Complemental strand, 24254514 - 24254429
Alignment:
| Q |
89 |
aaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggcttt |
178 |
Q |
| |
|
||||||||||||||||||||| | ||| ||||| |||||||||||||| |||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
24254514 |
aaaatgtcgaaattgttaggctag---atgtcatgatcggggttcgaaccccagtac-tccacttgtgtgtgtgagtttataatgacttt |
24254429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #99
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 63 - 128
Target Start/End: Original strand, 28999372 - 28999434
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccgg |
128 |
Q |
| |
|
||||||||||| |||||||| ||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
28999372 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggc---cggatgccatgaccgg |
28999434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #100
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 75 - 170
Target Start/End: Original strand, 37771079 - 37771171
Alignment:
| Q |
75 |
ctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttata |
170 |
Q |
| |
|
|||||||| ||| |||||||||||||||||||||||| || ||||| ||||||||||| | |||||||||| |||||| |||||||||||| |
|
|
| T |
37771079 |
ctagctcaattggtaaaatgtcgaaattgttaggccgg---atatcatgatcggggttcgaattccggtacctccatttgtgtatgtgagtttata |
37771171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #101
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 68 - 174
Target Start/End: Original strand, 39467027 - 39467128
Alignment:
| Q |
68 |
agaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagttt |
167 |
Q |
| |
|
|||||| |||||||| ||||||||||| ||||||||||||| | |||| |||| |||||||||||||| ||||||| ||||||||||| ||||| |
|
|
| T |
39467027 |
agaagtcctagctcaactggcaaaatggtaaaattgttaggccag---atgctatgatcggggttcgaaccccggtaccttcacttgtgtgta--agttt |
39467121 |
T |
 |
| Q |
168 |
ataatgg |
174 |
Q |
| |
|
||||||| |
|
|
| T |
39467122 |
ataatgg |
39467128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #102
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 143 - 184
Target Start/End: Complemental strand, 45191613 - 45191572
Alignment:
| Q |
143 |
tacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
45191613 |
tacctccacttgtgtgtgtgagtttataatggctttgccatt |
45191572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #103
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 119 - 172
Target Start/End: Original strand, 48302335 - 48302388
Alignment:
| Q |
119 |
ccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataat |
172 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| |||||||||||||||||| |
|
|
| T |
48302335 |
ccatgaccggggttcgaatcccagtacctccacttatgtgtgtgagtttataat |
48302388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #104
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 70 - 184
Target Start/End: Complemental strand, 38886512 - 38886401
Alignment:
| Q |
70 |
aagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttat |
169 |
Q |
| |
|
|||| |||||||| |||| ||||| ||||||||||||||| | | ||| |||| |||| |||||||| | ||||||||||||||||||| ||||| |
|
|
| T |
38886512 |
aagtcctagctcaactggtaaaataccgaaattgttaggccag---acgccttgacggggggtcgaacccccgcccctccacttgtgtgtgtgaatttat |
38886416 |
T |
 |
| Q |
170 |
aatggctttggcatt |
184 |
Q |
| |
|
|||||||||| |||| |
|
|
| T |
38886415 |
aatggctttgccatt |
38886401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #105
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 114 - 178
Target Start/End: Original strand, 48474766 - 48474830
Alignment:
| Q |
114 |
ggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggcttt |
178 |
Q |
| |
|
|||||||||||| ||||||||| || ||| ||||||||| | |||||||||||||||||||||| |
|
|
| T |
48474766 |
ggatgccatgactagggttcgaatcccggttcctccacttatatgtgtgagtttataatggcttt |
48474830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #106
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 68 - 161
Target Start/End: Complemental strand, 3840487 - 3840398
Alignment:
| Q |
68 |
agaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgt |
161 |
Q |
| |
|
|||||| |||||||| |||||||||||||||||||||||||| ||||| ||||| |||||||||| | ||||||||| ||||||||||| |
|
|
| T |
3840487 |
agaagtcctagctcaactggcaaaatgtcgaaattgttaggc---tggatgtcatga-tggggttcgaatctcggtacctcctcttgtgtgtgt |
3840398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #107
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 113 - 184
Target Start/End: Complemental strand, 44623101 - 44623030
Alignment:
| Q |
113 |
cggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||| ||||| |||||||||||| ||||| ||||||| ||| ||||||||||||||||||||| |||| |
|
|
| T |
44623101 |
cggatgtcatgatcggggttcgaacttcggtacttccacttatgtatgtgagtttataatggctttgtcatt |
44623030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #108
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 89 - 184
Target Start/End: Original strand, 3628679 - 3628775
Alignment:
| Q |
89 |
aaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccac--ttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||| |||||||||||||| || ||| | | ||| |||||||||||| | || |||||||| |||||||||||||||||| ||||||||| |||| |
|
|
| T |
3628679 |
aaaatgccgaaattgttaggcggg-ggacgtcttgatcggggttcgaactccggcacctccacctttgtgtgtgtgagtttatgatggctttgtcatt |
3628775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #109
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 130 - 172
Target Start/End: Complemental strand, 22561224 - 22561182
Alignment:
| Q |
130 |
gttcgaaccctggtacctccacttgtgtgtgtgagtttataat |
172 |
Q |
| |
|
|||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
22561224 |
gttcaaaccccggtacctccacttgtgtgtgtgagtttataat |
22561182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #110
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 62 - 112
Target Start/End: Original strand, 30455201 - 30455251
Alignment:
| Q |
62 |
atatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccgg |
112 |
Q |
| |
|
|||||||||||| |||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
30455201 |
atatccagaagtcctagctcaactgataaaatgtcgaaattgttaggccgg |
30455251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #111
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 89 - 184
Target Start/End: Original strand, 5511807 - 5511899
Alignment:
| Q |
89 |
aaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||||||| | ||||||||| ||||||||||| |||||||||| || ||| |||||||||||||||| |||| |||| |
|
|
| T |
5511807 |
aaaatgtcgaaattgttaggctga---atgccatgattggggttcgaacttcggtacctccatttatgtatgtgagtttataatggttttgtcatt |
5511899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #112
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 70 - 179
Target Start/End: Complemental strand, 7204632 - 7204524
Alignment:
| Q |
70 |
aagttctagctcagctggcaaaa-tgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccac-ttgtgtgtgtgagttt |
167 |
Q |
| |
|
|||| |||||||| ||||||||| || |||||||||||||||| | |||||||||||||||||||| | ||||||||| |||||| ||||||||| |
|
|
| T |
7204632 |
aagtcctagctcaactggcaaaaatgccgaaattgttaggccga---acatcatgaccggggttcgaaccccgatacctccactttgtgtatgtgagttt |
7204536 |
T |
 |
| Q |
168 |
ataatggctttg |
179 |
Q |
| |
|
|| |||||||| |
|
|
| T |
7204535 |
atggtggctttg |
7204524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #113
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 141 - 184
Target Start/End: Original strand, 30455263 - 30455306
Alignment:
| Q |
141 |
ggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||| |||| |
|
|
| T |
30455263 |
ggtacctccacttgtgtatgtgagtttataatgactttgccatt |
30455306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #114
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 126 - 184
Target Start/End: Complemental strand, 12500605 - 12500547
Alignment:
| Q |
126 |
cggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||| | | ||||||||||| ||||| |||||| |||||||||||| |||| |
|
|
| T |
12500605 |
cggggttcgaactccgatacctccacttatgtgtatgagttcataatggctttgtcatt |
12500547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #115
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 96 - 184
Target Start/End: Complemental strand, 16084330 - 16084246
Alignment:
| Q |
96 |
cgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||| ||||||||| ||||||| |||||| ||||| ||||| |||||||||| |||||||| ||||| |||| |
|
|
| T |
16084330 |
cgaaattgttaggccgg---atgccatgatcggggtttgaaccccaataccttcacttatgtgtgtgag-ttataatgtctttgtcatt |
16084246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #116
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 120 - 169
Target Start/End: Original strand, 2735843 - 2735892
Alignment:
| Q |
120 |
catgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttat |
169 |
Q |
| |
|
|||||||| |||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
2735843 |
catgaccgttgttcgaaccccgacacctccacttgtgtgtgtgagtttat |
2735892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #117
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 135 - 184
Target Start/End: Complemental strand, 7599585 - 7599536
Alignment:
| Q |
135 |
aaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||| || |||||||||||| |||||||||||||| |||||| |||| |
|
|
| T |
7599585 |
aaccctgatatctccacttgtgtctgtgagtttataatagctttgtcatt |
7599536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #118
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 89 - 179
Target Start/End: Complemental strand, 40326824 - 40326738
Alignment:
| Q |
89 |
aaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttg |
179 |
Q |
| |
|
|||||| |||||||||||||| ||||| |||| ||| |||||||||| | ||||| || |||||||||||| |||||||||| |||| |
|
|
| T |
40326824 |
aaaatgccgaaattgttaggc----ggatgttatgatcggagttcgaaccccgataccttcatttgtgtgtgtgaatttataatggttttg |
40326738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #119
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 113 - 174
Target Start/End: Complemental strand, 45458738 - 45458677
Alignment:
| Q |
113 |
cggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatgg |
174 |
Q |
| |
|
||||||| ||||| ||||||||||||| | |||||||| || |||||||| ||||| ||||| |
|
|
| T |
45458738 |
cggatgctatgacaggggttcgaaccccgatacctccatttatgtgtgtgggtttacaatgg |
45458677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #120
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 120 - 184
Target Start/End: Complemental strand, 49479069 - 49479004
Alignment:
| Q |
120 |
catgaccggggttcgaaccctggtacctccactt-gtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||||| |||| ||| |||||| |||| ||||||||||| ||| ||||| |||| |
|
|
| T |
49479069 |
catgaccggggttcgaactctggcaccgccacttcgtgtttgtgagtttatgatgactttgtcatt |
49479004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #121
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 127 - 178
Target Start/End: Original strand, 12502759 - 12502811
Alignment:
| Q |
127 |
ggggttcgaaccctggtacctccactt-gtgtgtgtgagtttataatggcttt |
178 |
Q |
| |
|
||||||||||| | |||||||| |||| |||||||||||||||| |||||||| |
|
|
| T |
12502759 |
ggggttcgaactccggtacctcaactttgtgtgtgtgagtttatgatggcttt |
12502811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #122
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 123 - 179
Target Start/End: Complemental strand, 26763417 - 26763361
Alignment:
| Q |
123 |
gaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttg |
179 |
Q |
| |
|
|||||||||||||||| || ||||| ||||||||||||||||||| || |||||| |
|
|
| T |
26763417 |
gaccggggttcgaacctctgtgcctccgcttgtgtgtgtgagtttatgatagctttg |
26763361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #123
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 125 - 184
Target Start/End: Original strand, 27868335 - 27868395
Alignment:
| Q |
125 |
ccggggttcgaaccctggtacctccactt-gtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||| |||| ||||| ||||||| |||||||||||||||| ||||||||| |||| |
|
|
| T |
27868335 |
ccggggttcaaacctcggtacttccactttgtgtgtgtgagtttatgatggctttgccatt |
27868395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #124
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 120 - 179
Target Start/End: Complemental strand, 44836194 - 44836134
Alignment:
| Q |
120 |
catgaccggggttcgaaccctggtacctccac-ttgtgtgtgtgagtttataatggctttg |
179 |
Q |
| |
|
||||| |||||||||||||| |||| |||||| || | ||||||||||||| ||||||||| |
|
|
| T |
44836194 |
catgatcggggttcgaaccccggtatctccactttatatgtgtgagtttatgatggctttg |
44836134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 88; Significance: 3e-42; HSPs: 141)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 67 - 184
Target Start/End: Original strand, 26690696 - 26690810
Alignment:
| Q |
67 |
cagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtt |
166 |
Q |
| |
|
||||||| |||||||| ||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26690696 |
cagaagtcctagctcaactggcaaaatgccgaaattgttaggccgg---atgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtt |
26690792 |
T |
 |
| Q |
167 |
tataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||| |||| |
|
|
| T |
26690793 |
tataatggctttgccatt |
26690810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 62 - 184
Target Start/End: Original strand, 14188087 - 14188206
Alignment:
| Q |
62 |
atatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgt |
161 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||||||||||||||||| ||||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
14188087 |
atatccagaagtcctagctcaactggcaaaatgtcgaaattgttaggccgg---atgccatgacctgggttcgaaccccggtacctccacttgtgtgtgt |
14188183 |
T |
 |
| Q |
162 |
gagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||| ||||| |||| |
|
|
| T |
14188184 |
gagtttataatgactttgccatt |
14188206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 84; E-Value: 7e-40
Query Start/End: Original strand, 67 - 184
Target Start/End: Original strand, 37295128 - 37295242
Alignment:
| Q |
67 |
cagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtt |
166 |
Q |
| |
|
||||||| |||||||| ||||||||||| ||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
37295128 |
cagaagtcctagctcaactggcaaaatgccgaaattgttaggccgg---atgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtt |
37295224 |
T |
 |
| Q |
167 |
tataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||| |||| |
|
|
| T |
37295225 |
tataatggctttgtcatt |
37295242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 64 - 184
Target Start/End: Complemental strand, 4430864 - 4430747
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| ||||||||||| ||||||||||||||||| ||| |||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4430864 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccgg---atgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtga |
4430768 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
4430767 |
gtttataatggctttgccatt |
4430747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 6317299 - 6317416
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| ||||||||||| ||||||||||||||||| ||| |||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6317299 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccgg---atgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtga |
6317395 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
6317396 |
gtttataatggctttgccatt |
6317416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 27928157 - 27928274
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| ||||||||||| |||||||||||| |||| |||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
27928157 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttagaccgg---atgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtga |
27928253 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
27928254 |
gtttataatggctttgccatt |
27928274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 64 - 184
Target Start/End: Complemental strand, 34711684 - 34711567
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| ||||||||||| ||||||||||||| ||| |||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
34711684 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggtcgg---atgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtga |
34711588 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
34711587 |
gtttataatggctttgccatt |
34711567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 63 - 184
Target Start/End: Complemental strand, 4977164 - 4977046
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| |||||||| ||||||||||| ||||||||||||||||| | ||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
4977164 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccgg---accccatgaccggggttcgaaccccggtacctccacttgtgtgtgtg |
4977068 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
4977067 |
agtttataatggctttgccatt |
4977046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 63 - 184
Target Start/End: Original strand, 25250783 - 25250901
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| |||||||| ||||||||||| | ||||||||||||||| |||||||||||||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
25250783 |
tatccagaagtcctagctcaactggcaaaatgccaaaattgttaggccgg---atgccatgaccggggttcgaaccccggtacctccacttatgtgtgtg |
25250879 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
25250880 |
agtttataatggctttgccatt |
25250901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 63 - 184
Target Start/End: Original strand, 36586480 - 36586598
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| |||||||| ||||||||||| ||||||||||||| ||| |||||||||||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
36586480 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggtcgg---atgccatgaccggggttcgaaccccggtacctccacttgtatgtgtg |
36586576 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
36586577 |
agtttataatggctttgtcatt |
36586598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 63 - 184
Target Start/End: Complemental strand, 38953610 - 38953492
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| ||||||| ||||||||||| ||||||||||||||||| ||| |||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
38953610 |
tatccagaagtcttagctcaactggcaaaatgccgaaattgttaggccgg---atgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtg |
38953514 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
38953513 |
agtttataatggctttgccatt |
38953492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 79; E-Value: 7e-37
Query Start/End: Original strand, 68 - 184
Target Start/End: Original strand, 10096615 - 10096728
Alignment:
| Q |
68 |
agaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagttt |
167 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||| | ||||||||||| ||||||||||||| |
|
|
| T |
10096615 |
agaagtcctagctcaactggcaaaatgtcgaaattgttaggccgg---atgccatgaccggggttcgaaccccgatacctccacttatgtgtgtgagttt |
10096711 |
T |
 |
| Q |
168 |
ataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||| |||| |
|
|
| T |
10096712 |
ataatggctttgccatt |
10096728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 79; E-Value: 7e-37
Query Start/End: Original strand, 64 - 184
Target Start/End: Complemental strand, 19649627 - 19649510
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| ||||||| ||||||||||| ||||||||||||||||| |||||||||||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
19649627 |
atccagaagtcatagctcaactggcaaaatgccgaaattgttaggccgg---atgccatgaccggggttcgaaccccggtacctccacttatgtgtgtga |
19649531 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
19649530 |
gtttataatggctttgtcatt |
19649510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 79; E-Value: 7e-37
Query Start/End: Original strand, 68 - 184
Target Start/End: Original strand, 44814866 - 44814979
Alignment:
| Q |
68 |
agaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagttt |
167 |
Q |
| |
|
|||||| |||||||| ||||||||||| ||||||||||||||||| ||| |||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
44814866 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccgg---atgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
44814962 |
T |
 |
| Q |
168 |
ataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||| |||| |
|
|
| T |
44814963 |
ataatggctttgccatt |
44814979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 62 - 184
Target Start/End: Original strand, 25199043 - 25199162
Alignment:
| Q |
62 |
atatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgt |
161 |
Q |
| |
|
|||||||||||| |||||||| |||| |||||| ||||||||||||||||| |||| ||||||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
25199043 |
atatccagaagtcctagctcaactggtaaaatgccgaaattgttaggccgg---atgctatgaccgggtttcgaaccccggtacctccacttgtgtgtgt |
25199139 |
T |
 |
| Q |
162 |
gagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||||| |||| |
|
|
| T |
25199140 |
gagtttataatggctttgccatt |
25199162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 62 - 184
Target Start/End: Complemental strand, 38070612 - 38070493
Alignment:
| Q |
62 |
atatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgt |
161 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||| ||||||||||||||||| ||| |||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
38070612 |
atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccgg---atgacatgaccgggattcgaaccacggtacctccacttgtgtgtgt |
38070516 |
T |
 |
| Q |
162 |
gagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||||| |||| |
|
|
| T |
38070515 |
gagtttataatggctttgccatt |
38070493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 25063338 - 25063456
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaa-tgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
|||||||||| |||| ||| ||||||||| || ||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
25063338 |
atccagaagtcctagttcaactggcaaaaatgccgaaattgttaggccgg---atgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtg |
25063434 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
25063435 |
agtttataatggctttgccatt |
25063456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 63 - 184
Target Start/End: Complemental strand, 27545046 - 27544928
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||| ||| ||| ||| ||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
27545046 |
tatccagaagttctagctcaactggcaaaatgtcgaaattgttaggtcgg---atgttatgtccggggttcgaaccccggtacctccacttgtgcgtgtg |
27544950 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
27544949 |
agtttataatggctttgccatt |
27544928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 63 - 184
Target Start/End: Original strand, 37817374 - 37817492
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
|||||| |||| |||||||| ||||||||||| ||||||||||||| ||| |||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
37817374 |
tatccataagtcctagctcaactggcaaaatgacgaaattgttaggtcgg---atgccatgaccggggttcgaaccccgatacctccacttgtgtgtgtg |
37817470 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
37817471 |
agtttataatggctttgtcatt |
37817492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 2733615 - 2733731
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
2733615 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggc---cggatgccatgaccggggttcgaaccccggtacc-ccacttgtgtgtgtga |
2733710 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||| |||||| |||| |
|
|
| T |
2733711 |
gtttataatagctttgccatt |
2733731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 4312132 - 4312249
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| ||||||||||| ||||||||||||| ||| |||||||||| ||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
4312132 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggtcgg---atgccatgactggggttcgaactccggtacctccacttgtgtgtgtga |
4312228 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
4312229 |
gtttataatggctttgccatt |
4312249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 64 - 184
Target Start/End: Complemental strand, 5704757 - 5704640
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
||||| |||| |||||||| ||| ||||||||||||||||||||||| | ||||||||||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
5704757 |
atccacaagtcctagctcaactgacaaaatgtcgaaattgttaggccag---atgccatgaccggggtttgaaccccggtacctccacttgtgtgtgtga |
5704661 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
5704660 |
gtttataatggctttgccatt |
5704640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 24654973 - 24655090
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| ||||||||||| | ||||||||||||||| |||||||||| ||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
24654973 |
atccagaagtcctagctcaactggcaaaatgccaaaattgttaggccgg---atgccatgactggggttcgaaccccggtaccttcacttgtgtgtgtga |
24655069 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
24655070 |
gtttataatggctttgccatt |
24655090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 64 - 184
Target Start/End: Complemental strand, 40744371 - 40744254
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||| ||||||||||||| | ||||||||||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
40744371 |
atccagaagtcctagctcaactggcaaaatgtcaaaattgttaggccag---atgccatgaccggagttcgaaccctagtacctccacttgtgtgtgtga |
40744275 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||| |||| |||| |
|
|
| T |
40744274 |
gtttataatggttttgccatt |
40744254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 61 - 184
Target Start/End: Complemental strand, 7772182 - 7772062
Alignment:
| Q |
61 |
tatatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtg |
160 |
Q |
| |
|
||||||||||||| |||||||| |||| |||||| ||||||||||||||||| ||| ||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
7772182 |
tatatccagaagtcctagctcaactggtaaaatgccgaaattgttaggccgg---atgtcatgatcggggttcgaaccccggtacctccacttgtgtgtg |
7772086 |
T |
 |
| Q |
161 |
tgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||| ||||| |||| |
|
|
| T |
7772085 |
tgagtttataatgactttgccatt |
7772062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 64 - 178
Target Start/End: Original strand, 26737970 - 26738081
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| |||| |||||| ||||||||||||||||| ||| |||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
26737970 |
atccagaagtcctagctcaactggtaaaatgccgaaattgttaggccgg---atgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtga |
26738066 |
T |
 |
| Q |
164 |
gtttataatggcttt |
178 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
26738067 |
atttataatggcttt |
26738081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 67 - 184
Target Start/End: Original strand, 23681012 - 23681126
Alignment:
| Q |
67 |
cagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtt |
166 |
Q |
| |
|
||||||| ||| |||| ||||||||||| | ||||| ||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
23681012 |
cagaagtcctaactcaactggcaaaatgccaaaattattaggccgg---atgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtt |
23681108 |
T |
 |
| Q |
167 |
tataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||| |||| |
|
|
| T |
23681109 |
tataatggctttgccatt |
23681126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 67 - 184
Target Start/End: Original strand, 26675559 - 26675673
Alignment:
| Q |
67 |
cagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtt |
166 |
Q |
| |
|
||||||| |||||||| |||| |||||| ||||||||||||||||| || ||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
26675559 |
cagaagtcctagctcaactggtaaaatgccgaaattgttaggccgg---atatcatgaccggggtttgaaccctggtacctccacttgtgtgtgtgagtt |
26675655 |
T |
 |
| Q |
167 |
tataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||| |||| |
|
|
| T |
26675656 |
tataatggctttgccatt |
26675673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 63 - 184
Target Start/End: Complemental strand, 37708577 - 37708459
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
|||||| |||| |||||||| ||||||||||| ||||||||||||| ||| |||| ||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
37708577 |
tatccataagtcctagctcaactggcaaaatgccgaaattgttaggacgg---atgctatgaccggggttcgaaccccggtacctccacttgtgtgtgta |
37708481 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
37708480 |
agtttataatggctttgtcatt |
37708459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 64 - 184
Target Start/End: Complemental strand, 35421747 - 35421631
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||| ||| |||||||||||||||||||||||||| || |||||||||||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
35421747 |
atccagaagtcctagttcaactggcaaaatgtcgaaattgttaggc---cgaatgccatgaccggggttcgaaccccagtacctccacttgtgt-tgtga |
35421652 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
35421651 |
gtttataatggctttgccatt |
35421631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 63 - 184
Target Start/End: Original strand, 2442760 - 2442876
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
|||||| |||| |||||||| |||||||||||||||||||||||||| ||||||||||||||||| ||| ||||| |||||||||||| |||||||| |
|
|
| T |
2442760 |
tatccataagtcctagctcaactggcaaaatgtcgaaattgttaggc---cggatgccatgaccgggattcaaaccccggtacctccact--tgtgtgtg |
2442854 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
2442855 |
agtttataatggctttgccatt |
2442876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 67 - 184
Target Start/End: Original strand, 25893853 - 25893967
Alignment:
| Q |
67 |
cagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtt |
166 |
Q |
| |
|
||||||| |||||||| ||||||||||| |||||||||||||||| ||||||||| |||||||||||||| |||||||||| |||||||||| |||| |
|
|
| T |
25893853 |
cagaagtcctagctcaactggcaaaatgctgaaattgttaggccgg---atgccatgatcggggttcgaaccccggtacctccatttgtgtgtgtaagtt |
25893949 |
T |
 |
| Q |
167 |
tataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||| |||| |
|
|
| T |
25893950 |
tataatggctttgccatt |
25893967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 67 - 184
Target Start/End: Complemental strand, 34540190 - 34540076
Alignment:
| Q |
67 |
cagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtt |
166 |
Q |
| |
|
||||||| |||| ||| ||||||||||| ||||||||||||||||| ||||||||| ||||||| ||| || |||||||||||||||||||||||||| |
|
|
| T |
34540190 |
cagaagtcctagttcaactggcaaaatgccgaaattgttaggccgg---atgccatgatcggggtttgaatcccggtacctccacttgtgtgtgtgagtt |
34540094 |
T |
 |
| Q |
167 |
tataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||| |||| |
|
|
| T |
34540093 |
tataatggctttgccatt |
34540076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 59 - 184
Target Start/End: Complemental strand, 34744400 - 34744278
Alignment:
| Q |
59 |
tttatatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtg |
158 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||||| ||| ||||||||| ||||||||||||| || |||||||||| ||||||||||||| |||| |
|
|
| T |
34744400 |
tttatatccagaagtcatagctcaactggcaaaatgccgatattgttagg---gcggatgccatgatcgtggttcgaacctcggtacctccacttatgtg |
34744304 |
T |
 |
| Q |
159 |
tgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||||||| |||| |
|
|
| T |
34744303 |
tgtgagtttataatggctttgccatt |
34744278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 64 - 184
Target Start/End: Complemental strand, 11100417 - 11100300
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| |||| |||||| ||||||||||||||||| ||||||||| ||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
11100417 |
atccagaagtcctagctcaactggaaaaatgccgaaattgttaggccgg---atgccatgatcggagttcgaaccccggtacctccacttgtgtgtgtgg |
11100321 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||| |||| |||| |
|
|
| T |
11100320 |
gtttataatggttttgtcatt |
11100300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 62 - 184
Target Start/End: Original strand, 3054021 - 3054140
Alignment:
| Q |
62 |
atatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgt |
161 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||| | ||||||||| || ||| ||||||||||||||||| |
|
|
| T |
3054021 |
atatccagaagttctagctcaactggcaaaatgccgaaattgttaggc---cggatgccatga-ctgggttcgaaacccggtgcctccacttgtgtgtgt |
3054116 |
T |
 |
| Q |
162 |
gag-tttataatggctttggcatt |
184 |
Q |
| |
|
||| ||||||||||||||| |||| |
|
|
| T |
3054117 |
gagttttataatggctttgtcatt |
3054140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 89 - 184
Target Start/End: Complemental strand, 17919919 - 17919827
Alignment:
| Q |
89 |
aaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
17919919 |
aaaatgtcgatattgttaggccgg---atgccatgaccggggttcgaacctcggtacctccacttgtgtgtgtgagtttataatggctttgtcatt |
17919827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 41562441 - 41562560
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccact--tgtgtgtgt |
161 |
Q |
| |
|
|||||||||| |||||||| |||| |||||||||||||||||||||||| |||| |||| |||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
41562441 |
atccagaagtcctagctcaactggtaaaatgtcgaaattgttaggccgg---atgctatgatcggggttcgaaccccggtacctccacttgtgtgtgtgt |
41562537 |
T |
 |
| Q |
162 |
gagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||| |||| |||| |
|
|
| T |
41562538 |
gagtttataatggttttgccatt |
41562560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 76 - 184
Target Start/End: Original strand, 9569735 - 9569841
Alignment:
| Q |
76 |
tagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgag-tttataatgg |
174 |
Q |
| |
|
||||||| ||||||||||| ||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||| ||||||| ||||||||| |
|
|
| T |
9569735 |
tagctcaactggcaaaatgccgaaattgttaggccgg---atgccatgaccggggttcgaaccccggtacctccacttgtgggtgtgagttttataatga |
9569831 |
T |
 |
| Q |
175 |
ctttggcatt |
184 |
Q |
| |
|
||||| |||| |
|
|
| T |
9569832 |
ctttgccatt |
9569841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 87 - 184
Target Start/End: Complemental strand, 27817555 - 27817461
Alignment:
| Q |
87 |
gcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||| |||||||||||| |||| ||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
27817555 |
gcaaaatgccgaaattgttagaccgg---atgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataatggctttgccatt |
27817461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 64 - 184
Target Start/End: Complemental strand, 27849872 - 27849755
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaa-tgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
|||||||||| ||| |||| ||| ||||| || ||||||||||||||||| |||| ||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
27849872 |
atccagaagtcctaactcaactgacaaaaatgccgaaattgttaggccgg---atgc-atgaccggggttcgaaccccggtacctccacttgtgtgtgtg |
27849777 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
27849776 |
agtttataatggctttgccatt |
27849755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 63 - 184
Target Start/End: Complemental strand, 31639232 - 31639114
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| ||| |||| || |||||||| ||||||||||||||||| |||||||||||||||||||||| | ||||||||||||| |||||||| |
|
|
| T |
31639232 |
tatccagaagtcctaactcaactagcaaaatgccgaaattgttaggccgg---atgccatgaccggggttcgaactccggtacctccacttatgtgtgtg |
31639136 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||| ||||| |||| |
|
|
| T |
31639135 |
ggtttataatgactttgccatt |
31639114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 64 - 178
Target Start/End: Complemental strand, 5895924 - 5895813
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
||||| |||| |||||||| |||||||||||||||||||||||||||| |||| |||| |||||||||||||| ||||| |||| |||||||||||| |
|
|
| T |
5895924 |
atccataagtcctagctcaactggcaaaatgtcgaaattgttaggccga---atgctatgatcggggttcgaaccccggtacatccaattgtgtgtgtga |
5895828 |
T |
 |
| Q |
164 |
gtttataatggcttt |
178 |
Q |
| |
|
|||||||||| |||| |
|
|
| T |
5895827 |
gtttataatgacttt |
5895813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 63 - 184
Target Start/End: Complemental strand, 9998773 - 9998654
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
|||| |||||| |||| ||| ||||||||||| ||||||||||||||||| || |||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
9998773 |
tatctagaagtcctagttcaactggcaaaatgccgaaattgttaggccgg---atatcatgaccggggttcgaaccccggtacctccacttgtgtgtgtg |
9998677 |
T |
 |
| Q |
163 |
ag-tttataatggctttggcatt |
184 |
Q |
| |
|
|| ||||||||| ||||| |||| |
|
|
| T |
9998676 |
agttttataatgactttgccatt |
9998654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 63 - 184
Target Start/End: Complemental strand, 33067518 - 33067402
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||| ||||| |||||||| ||||||||||| ||||||||||||||||| ||||||||| |||||||||||| | |||||||||||||||| |||| |
|
|
| T |
33067518 |
tatccggaagtcctagctcaactggcaaaatgccgaaattgttaggccgg---atgccatgatcggggttcgaactccggtacctccacttgtg--tgtg |
33067424 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||| ||||| |||| |
|
|
| T |
33067423 |
agtttataatgactttgccatt |
33067402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 63 - 184
Target Start/End: Original strand, 40344488 - 40344605
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| |||| ||| ||| ||||||| |||||||||||| | ||||| ||||| |||||||||||||||||||||||||||| |||||||| |
|
|
| T |
40344488 |
tatccagaagtcctagttcaactgtcaaaatgccgaaattgttagcc----ggatgtcatgaacggggttcgaaccctggtacctccacttatgtgtgtg |
40344583 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||| ||||| |||| |
|
|
| T |
40344584 |
agtttataatgactttgccatt |
40344605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 67 - 184
Target Start/End: Original strand, 14243701 - 14243815
Alignment:
| Q |
67 |
cagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtt |
166 |
Q |
| |
|
||||||| |||||||| |||| |||||| |||||||||||||| | ||| |||||||| ||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
14243701 |
cagaagtcctagctcaactggtaaaatgccgaaattgttaggctga---atgtcatgaccgaggttcgaaccccggtacctccatttgtgtgtgtgagtt |
14243797 |
T |
 |
| Q |
167 |
tataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||| |||| |
|
|
| T |
14243798 |
tataatggctttgccatt |
14243815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 63 - 184
Target Start/End: Original strand, 20150219 - 20150337
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||| | |||||||| ||||||||||||| ||||||||||||||| ||| ||||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
20150219 |
tatccagaattcctagctcaactggcaaaatgtcaaaattgttaggccgg---atgtcatgaccggaattcgaaccccaatacctccacttgtgtgtgtg |
20150315 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||| |||||| |||| |
|
|
| T |
20150316 |
agtttataatagctttgtcatt |
20150337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 63 - 184
Target Start/End: Complemental strand, 34143484 - 34143366
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| ||| |||| | |||||||| ||||||||||||||||| ||||||||||||||||||| ||| ||||||||||||| |||||||| |
|
|
| T |
34143484 |
tatccagaagtcctaactcaattagcaaaatgccgaaattgttaggccgg---atgccatgaccggggttcggacctcggtacctccacttatgtgtgtg |
34143388 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||| |||||| |||| |
|
|
| T |
34143387 |
agtttataatagctttgccatt |
34143366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 63 - 184
Target Start/End: Original strand, 35810235 - 35810353
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
|||||| ||||| ||||||| ||||||||||| ||||||||||||||||| ||||||||||||||||| |||| | ||||||||||||| ||||| | |
|
|
| T |
35810235 |
tatccacaagttatagctcaactggcaaaatgccgaaattgttaggccgg---atgccatgaccggggtttgaactccggtacctccacttttgtgtata |
35810331 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||| ||||| |||| |
|
|
| T |
35810332 |
agtttataatgactttgtcatt |
35810353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 16395372 - 16395489
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| ||| |||| |||| |||||| |||||||||||||||| || | ||||||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
16395372 |
atccagaagtcctaactcaactggtaaaatgctgaaattgttaggccgg---atactatgaccggggttcgaaccccggtacctccatttgtgtgtgtga |
16395468 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||| ||||| |||| |
|
|
| T |
16395469 |
gtttataatgactttgccatt |
16395489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 62 - 178
Target Start/End: Original strand, 18040133 - 18040246
Alignment:
| Q |
62 |
atatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgt |
161 |
Q |
| |
|
|||||||||||| |||||||| ||| |||||| |||||||||||||||| ||| ||||||| | ||||||||| ||||||||||||||||||||| |
|
|
| T |
18040133 |
atatccagaagtcctagctcaactgataaaatgctgaaattgttaggccgg---atgtcatgacccagattcgaaccccggtacctccacttgtgtgtgt |
18040229 |
T |
 |
| Q |
162 |
gagtttataatggcttt |
178 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
18040230 |
gagtttataatggcttt |
18040246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 96 - 184
Target Start/End: Complemental strand, 40772662 - 40772577
Alignment:
| Q |
96 |
cgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||| ||||||||| |||||||||||||| ||||||| ||||||||||||||||||||||||||||||| |||| |
|
|
| T |
40772662 |
cgaaattgttaggccgg---atgccatgatcggggttcgaaccccggtaccttcacttgtgtgtgtgagtttataatggctttgccatt |
40772577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 66 - 184
Target Start/End: Complemental strand, 6845110 - 6844997
Alignment:
| Q |
66 |
ccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagt |
165 |
Q |
| |
|
|||||||| |||||||| |||||||||| ||||||||||||||||| ||||||||||||||||||||| || ||||||||| || ||| ||||||| |
|
|
| T |
6845110 |
ccagaagtcctagctcaattggcaaaatgccgaaattgttaggccgg---atgccatgaccggggttcgaatcccggtacctccgct--tgtatgtgagt |
6845016 |
T |
 |
| Q |
166 |
ttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||| |||| |
|
|
| T |
6845015 |
ttataatggctttgccatt |
6844997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 89 - 184
Target Start/End: Original strand, 20993561 - 20993653
Alignment:
| Q |
89 |
aaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||||||||||| |||| |||| |||||||||||||| ||||||||||||| |||||||||||||||||| |||||| |||| |
|
|
| T |
20993561 |
aaaatgtcgaaattgttaggccgg---atgctatgatcggggttcgaaccccggtacctccacttatgtgtgtgagtttataatagctttgccatt |
20993653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 70 - 172
Target Start/End: Complemental strand, 44604944 - 44604845
Alignment:
| Q |
70 |
aagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttat |
169 |
Q |
| |
|
|||| |||||||| |||||||||| ||||||||||||| ||| ||||||||| |||||||||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
44604944 |
aagtcctagctcaattggcaaaatgccgaaattgttaggtcgg---atgccatgatcggggttcgaaccccggtacctccacttatgtgtgtgagtttat |
44604848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 67 - 184
Target Start/End: Original strand, 25213631 - 25213744
Alignment:
| Q |
67 |
cagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtt |
166 |
Q |
| |
|
||||||| |||||||| ||||||||||| |||||||||||| |||| ||||||||| |||||||||||||| ||| |||||||||||||||| | || |
|
|
| T |
25213631 |
cagaagtcctagctcaactggcaaaatgccgaaattgttagaccgg---atgccatgatcggggttcgaaccccggtgcctccacttgtgtgtgag-ttt |
25213726 |
T |
 |
| Q |
167 |
tataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||| |||| |
|
|
| T |
25213727 |
tataatggctttgtcatt |
25213744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 67 - 184
Target Start/End: Original strand, 29513878 - 29513991
Alignment:
| Q |
67 |
cagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtt |
166 |
Q |
| |
|
||||||| |||||||| ||| |||| || |||||||||||||| || || |||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29513878 |
cagaagtcctagctcaactgacaaa-tgccgaaattgttaggctgg---ataccatgattggggttcgaaccctggtacctccacttgtgtgtgtgagtt |
29513973 |
T |
 |
| Q |
167 |
tataatggctttggcatt |
184 |
Q |
| |
|
|||||| |||||| |||| |
|
|
| T |
29513974 |
tataatagctttgccatt |
29513991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 67 - 184
Target Start/End: Complemental strand, 39667021 - 39666907
Alignment:
| Q |
67 |
cagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtt |
166 |
Q |
| |
|
||||||| ||| |||| ||| ||||||| ||||||||||||||||| |||||||||| | ||||| ||||| | ||||||||||||||||| |||||| |
|
|
| T |
39667021 |
cagaagtcctaactcaactgacaaaatgccgaaattgttaggccgg---atgccatgactgtggttcaaaccccgatacctccacttgtgtgtatgagtt |
39666925 |
T |
 |
| Q |
167 |
tataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||| |||| |
|
|
| T |
39666924 |
tataatggctttgccatt |
39666907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 63 - 167
Target Start/End: Complemental strand, 4694817 - 4694716
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
|||||| |||| |||||||| ||||||||||||||||||||||||| ||| ||| |||||||||| ||| ||||| | |||||||||||||||||||| |
|
|
| T |
4694817 |
tatccataagtcctagctcaactggcaaaatgtcgaaattgttaggtcgg---atgtcatgaccgggattcaaaccccgctacctccacttgtgtgtgtg |
4694721 |
T |
 |
| Q |
163 |
agttt |
167 |
Q |
| |
|
||||| |
|
|
| T |
4694720 |
agttt |
4694716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 89 - 184
Target Start/End: Original strand, 6436707 - 6436799
Alignment:
| Q |
89 |
aaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgag-tttataatggctttggcatt |
184 |
Q |
| |
|
|||||| ||||||||||||||||| |||||||||||||||||||||||| ||| |||||||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
6436707 |
aaaatgccgaaattgttaggccgg---atgccatgaccggggttcgaaccccggt-cctccacttgtgtgtgtgagttttataatggctttgccatt |
6436799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 20662521 - 20662638
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| ||| |||| | | |||||| |||||||||||||||| ||||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
20662521 |
atccagaagtcctacctcaaccgctaaaatgctgaaattgttaggccgg---atgccatgaccggggttcgaatgccggtacctccacttgtgtgtgtga |
20662617 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||| ||||| |||| |
|
|
| T |
20662618 |
gtttataatgactttgtcatt |
20662638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 65 - 184
Target Start/End: Original strand, 403666 - 403782
Alignment:
| Q |
65 |
tccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgag |
164 |
Q |
| |
|
|||| |||| |||||||| ||| |||||| ||||||||||||| ||| |||||||||||||||||||||||| |||||||| |||||| ||| |||| |
|
|
| T |
403666 |
tccacaagtcctagctcaactgataaaatgccgaaattgttaggtcgg---atgccatgaccggggttcgaaccccggtacctctacttgtatgtatgag |
403762 |
T |
 |
| Q |
165 |
tttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||| |||| |||| |
|
|
| T |
403763 |
tttataatgggtttgtcatt |
403782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 89 - 184
Target Start/End: Original strand, 5917306 - 5917398
Alignment:
| Q |
89 |
aaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||| ||||||||||| ||| ||||||| ||||||||||| ||||||||||| |||||||||||||||||||||| ||||| |||| |
|
|
| T |
5917306 |
aaaatgtcgaaactgttaggccgg---atgtcatgaccagggttcgaaccatggtacctccatttgtgtgtgtgagtttataatgactttgtcatt |
5917398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #65
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 64 - 162
Target Start/End: Complemental strand, 24242715 - 24242619
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaa-tgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
|||||||||| ||| |||| | ||||||| || ||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
24242715 |
atccagaagtcctaactcaaccggcaaaaatgccgaaattgttaggccgg---atgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtg |
24242619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #66
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 113 - 178
Target Start/End: Original strand, 36055514 - 36055579
Alignment:
| Q |
113 |
cggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggcttt |
178 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
36055514 |
cggatgccatgaccggggttcgaaccccggtacctccacttatgtgtgtgagtttataatagcttt |
36055579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #67
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 78 - 184
Target Start/End: Complemental strand, 8525316 - 8525213
Alignment:
| Q |
78 |
gctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctt |
177 |
Q |
| |
|
||||| ||| ||||||| ||| |||||||| |||| |||||||||| ||||||||||||| |||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
8525316 |
gctcaactgacaaaatgccgacattgttagaccgg---atgccatgactggggttcgaaccccggtatctccacttgtgtgtgtgagtttattatggctt |
8525220 |
T |
 |
| Q |
178 |
tggcatt |
184 |
Q |
| |
|
|| |||| |
|
|
| T |
8525219 |
tgccatt |
8525213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #68
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 68 - 184
Target Start/End: Original strand, 16501651 - 16501763
Alignment:
| Q |
68 |
agaagttctagctcagctggcaaaa-tgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtt |
166 |
Q |
| |
|
|||||| |||||||| ||||||||| || || |||||||||| || |||||||||||||||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
16501651 |
agaagtcctagctcaactggcaaaaatgctgatattgttaggctgg---atgccatgaccggggttcgaaccccggtacctccact--tgtgtgtgagtt |
16501745 |
T |
 |
| Q |
167 |
tataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||| |||| |
|
|
| T |
16501746 |
tataatggctttgccatt |
16501763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #69
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 64 - 174
Target Start/End: Original strand, 21530779 - 21530886
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
||||||| ||||||||||| || ||||||| ||||||||||||| ||| |||||||||||| |||||||| || ||||||| ||||| ||||||||| |
|
|
| T |
21530779 |
atccagatgttctagctcaactagcaaaataccgaaattgttaggtcgg---atgccatgaccgaggttcgaatcccggtaccttcacttatgtgtgtga |
21530875 |
T |
 |
| Q |
164 |
gtttataatgg |
174 |
Q |
| |
|
||||||||||| |
|
|
| T |
21530876 |
gtttataatgg |
21530886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #70
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 85 - 184
Target Start/End: Complemental strand, 32922982 - 32922882
Alignment:
| Q |
85 |
tggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtg----tgtgagtttataatggctttgg |
180 |
Q |
| |
|
|||||||||| |||||||||||||| || |||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
32922982 |
tggcaaaatgccgaaattgttaggctgg---atgccatgaccggggttcgaaccccagtacctccacttgtgtgtgtgtgtgagtttataatggctttgt |
32922886 |
T |
 |
| Q |
181 |
catt |
184 |
Q |
| |
|
|||| |
|
|
| T |
32922885 |
catt |
32922882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #71
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 63 - 160
Target Start/End: Complemental strand, 26226841 - 26226748
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtg |
160 |
Q |
| |
|
||||||||||| | ||||||||||| |||||| |||||||||||||||| |||||||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
26226841 |
tatccagaagtccaagctcagctgg-aaaatgctgaaattgttaggccgg---atgccatgaccgaggttcgaaccccggtacctccacttgtgtgtg |
26226748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #72
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 63 - 159
Target Start/End: Original strand, 8569943 - 8570036
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgt |
159 |
Q |
| |
|
||||||||||| |||||||| ||||||||| ||||||||||||||||| |||| ||||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
8569943 |
tatccagaagtcctagctcaactggcaaaagaccgaaattgttaggccgg---atgcaatgactggggttcgaaccccggtacctccacttgtgtgt |
8570036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #73
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 13634845 - 13634962
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| ||||||| ||||||||||| ||||||||||||| | | ||| ||||| ||||||| |||| | ||||||||||||| ||||||||| |
|
|
| T |
13634845 |
atccagaagtcttagctcaactggcaaaatgccgaaattgttaggtcag---atgtcatgatcggggtttgaactccggtacctccacttatgtgtgtga |
13634941 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||| ||||| |||| |
|
|
| T |
13634942 |
gtttataatgactttgtcatt |
13634962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #74
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 13735258 - 13735375
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| ||||||| ||||||||||| ||||||||||||| | | ||| ||||| ||||||| |||| | ||||||||||||| ||||||||| |
|
|
| T |
13735258 |
atccagaagtcttagctcaactggcaaaatgccgaaattgttaggtcag---atgtcatgatcggggtttgaactccggtacctccacttatgtgtgtga |
13735354 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||| ||||| |||| |
|
|
| T |
13735355 |
gtttataatgactttgtcatt |
13735375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #75
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 89 - 184
Target Start/End: Complemental strand, 31941138 - 31941046
Alignment:
| Q |
89 |
aaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||| |||||||||||||| || ||| ||||| |||||||||||||| | ||||||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
31941138 |
aaaatgccgaaattgttaggctgg---atgtcatgatcggggttcgaaccccgatacctccacttatgtgtgtgagtttataatggctttgccatt |
31941046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #76
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 77 - 184
Target Start/End: Complemental strand, 35497752 - 35497648
Alignment:
| Q |
77 |
agctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggct |
176 |
Q |
| |
|
|||||| |||| |||||| | ||||||||||||||| ||| |||| |||||||| ||| | |||||||||||||||||||||||||||||||||||| |
|
|
| T |
35497752 |
agctcaactggtaaaatgccaaaattgttaggccgg---atgttatgatcggggttcaaactccggtacctccacttgtgtgtgtgagtttataatggct |
35497656 |
T |
 |
| Q |
177 |
ttggcatt |
184 |
Q |
| |
|
||| |||| |
|
|
| T |
35497655 |
ttgccatt |
35497648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #77
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 64 - 178
Target Start/End: Complemental strand, 8547259 - 8547148
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| ||||||||||| |||||||||||| | |||||| ||| ||||| |||||||| | | ||||||||||| ||||||||| |
|
|
| T |
8547259 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttag---gtcggatgtcataaccggagttcgaactccgatacctccacttatgtgtgtga |
8547163 |
T |
 |
| Q |
164 |
gtttataatggcttt |
178 |
Q |
| |
|
||||| || |||||| |
|
|
| T |
8547162 |
gtttacaacggcttt |
8547148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #78
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 76 - 178
Target Start/End: Original strand, 10006157 - 10006256
Alignment:
| Q |
76 |
tagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggc |
175 |
Q |
| |
|
||||||| ||||||||||||| |||||||||| |||| ||| ||||| |||||||||||||| |||||| ||||| ||||||||||||||||||| | |
|
|
| T |
10006157 |
tagctcaactggcaaaatgtcaaaattgttagaccgg---atgtcatgatcggggttcgaaccccagtaccttcacttatgtgtgtgagtttataatgac |
10006253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #79
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 63 - 184
Target Start/End: Complemental strand, 2508264 - 2508146
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| ||| |||| || ||||||| | ||||||||||| ||| ||| |||||||||||||||||| | | |||||| ||||||||||||| |
|
|
| T |
2508264 |
tatccagaagtcctaactcaactaacaaaatgccaaaattgttaggacgg---atgtcatgaccggggttcgaactccgatacctctacttgtgtgtgtg |
2508168 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||| |||||| |||| |
|
|
| T |
2508167 |
agtttataatagctttgtcatt |
2508146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #80
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 90 - 184
Target Start/End: Complemental strand, 5700752 - 5700659
Alignment:
| Q |
90 |
aaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccact--tgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||| ||||||||||||||||| |||| ||||||||||||||||||| ||||||||||| ||||||||||||||||||||| ||||| |||| |
|
|
| T |
5700752 |
aaatgccgaaattgttaggccgg---atgctatgaccggggttcgaaccccagtacctccacttatgtgtgtgtgagtttataatgactttgccatt |
5700659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #81
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 70 - 179
Target Start/End: Original strand, 14725774 - 14725880
Alignment:
| Q |
70 |
aagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttat |
169 |
Q |
| |
|
|||| |||||||| ||| |||||||||||||| ||||||| | || ||||| ||| |||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
14725774 |
aagtcctagctcaactgataaaatgtcgaaattattaggccag---atatcatgatcggagttcgaaccctgatacctccacttgtgtgtgtgagtttat |
14725870 |
T |
 |
| Q |
170 |
aatggctttg |
179 |
Q |
| |
|
||||| |||| |
|
|
| T |
14725871 |
aatggatttg |
14725880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #82
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 56 - 169
Target Start/End: Original strand, 40999744 - 40999854
Alignment:
| Q |
56 |
taatttatatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgt |
155 |
Q |
| |
|
|||||| |||||| || || ||||||| ||| |||||||||||||||||||||||| |||||||||||||| ||||||||| | ||||||||||| | |
|
|
| T |
40999744 |
taatttttatccataaattttagctcaactgataaaatgtcgaaattgttaggccgg---atgccatgaccgggattcgaaccccgatacctccacttat |
40999840 |
T |
 |
| Q |
156 |
gtgtgtgagtttat |
169 |
Q |
| |
|
|||| ||| ||||| |
|
|
| T |
40999841 |
gtgtatgactttat |
40999854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #83
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 67 - 184
Target Start/End: Original strand, 42922541 - 42922655
Alignment:
| Q |
67 |
cagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtt |
166 |
Q |
| |
|
||||||| ||||||| |||||||||||||||||||||| | ||| ||| | ||| |||||||||||||| |||| |||||||| |||||||||||| |
|
|
| T |
42922541 |
cagaagtcttagctcaactggcaaaatgtcgaaattgtttgatcgg---atgtcgtgatcggggttcgaaccccggtaactccacttatgtgtgtgagtt |
42922637 |
T |
 |
| Q |
167 |
tataatggctttggcatt |
184 |
Q |
| |
|
|||||| |||||| |||| |
|
|
| T |
42922638 |
tataatcgctttgtcatt |
42922655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #84
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 113 - 184
Target Start/End: Original strand, 43129141 - 43129212
Alignment:
| Q |
113 |
cggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||| |||| ||||||||| || |||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
43129141 |
cggatgccatgatcgggattcgaaccccggcacctccacttgtgtgtgtaagtttataatggctttgccatt |
43129212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #85
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 64 - 184
Target Start/End: Complemental strand, 10286594 - 10286477
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||| |||||||||| ||| || || ||| ||| ||||||||| |||| |||||||||| ||||||| |
|
|
| T |
10286594 |
atccagaagtcctagctcaactggcaaaatgtcaaaattgttagaccga---ataccgtgattgggattcgaaccccggtatctccacttgtatgtgtga |
10286498 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||| ||||| |||| |
|
|
| T |
10286497 |
gtttataatgactttgtcatt |
10286477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #86
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 68 - 184
Target Start/End: Original strand, 10617788 - 10617900
Alignment:
| Q |
68 |
agaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagttt |
167 |
Q |
| |
|
|||||| |||||||| ||| ||||||| ||| |||||||||| |||||| |||||| ||||||||||||| ||| ||||||||||| | ||||||||| |
|
|
| T |
10617788 |
agaagtcctagctcaactgacaaaatgccgacattgttaggc---cggatgtcatgactggggttcgaaccccggt-cctccacttgtatttgtgagttt |
10617883 |
T |
 |
| Q |
168 |
ataatggctttggcatt |
184 |
Q |
| |
|
|||||| ||||| |||| |
|
|
| T |
10617884 |
ataatgactttgccatt |
10617900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #87
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 86 - 178
Target Start/End: Complemental strand, 26732981 - 26732892
Alignment:
| Q |
86 |
ggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggcttt |
178 |
Q |
| |
|
|||||||||||||||||| |||| ||| ||| ||||| |||||||||||||| |||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
26732981 |
ggcaaaatgtcgaaattgctaggtcgg---atgtcatgatcggggttcgaaccccagtacctccacttgtgtgtttgaatttataatggcttt |
26732892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #88
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 84 - 184
Target Start/End: Complemental strand, 34642546 - 34642449
Alignment:
| Q |
84 |
ctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcat |
183 |
Q |
| |
|
||||||||||| ||||||||||||| ||| ||| |||||||||||||||||| |||||||| | |||||||||||||||||||||| ||||| ||| |
|
|
| T |
34642546 |
ctggcaaaatgccgaaattgttaggtcgg---atgtcatgaccggggttcgaacatcggtacctcaatttgtgtgtgtgagtttataatgactttgtcat |
34642450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #89
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 126 - 184
Target Start/End: Original strand, 36054029 - 36054087
Alignment:
| Q |
126 |
cggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
36054029 |
cggggttcgaaccccggtacctccacttgtgtgtgtgagtttataatggttttgccatt |
36054087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #90
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 61 - 184
Target Start/End: Original strand, 2589284 - 2589404
Alignment:
| Q |
61 |
tatatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtg |
160 |
Q |
| |
|
||||||| || ||||||||||| ||| ||||||| |||||||||||| | | ||||||||||||| |||||||||| |||| | ||||| ||| || |
|
|
| T |
2589284 |
tatatccggatgttctagctcaactgacaaaatgctgaaattgttaggtcag---atgccatgaccggagttcgaaccccggtattttcacttatgtatg |
2589380 |
T |
 |
| Q |
161 |
tgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||||| |||| |
|
|
| T |
2589381 |
tgagtttataatggctttgccatt |
2589404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #91
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 113 - 178
Target Start/End: Original strand, 36442351 - 36442416
Alignment:
| Q |
113 |
cggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggcttt |
178 |
Q |
| |
|
|||||| ||||| ||||||||||| | |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36442351 |
cggatgtcatgattggggttcgaactccggtacctccacttgtgtgtgtgagtttataatggcttt |
36442416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #92
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 70 - 173
Target Start/End: Original strand, 37953788 - 37953888
Alignment:
| Q |
70 |
aagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttat |
169 |
Q |
| |
|
|||| |||||||| |||| ||||||||||||||||||||| ||||||| |||| | ||||||||||| | ||||||||||| | ||||||||||||| |
|
|
| T |
37953788 |
aagtcctagctcaactggaaaaatgtcgaaattgttaggc---cggatgctatgattgtggttcgaaccccgatacctccacttatatgtgtgagtttat |
37953884 |
T |
 |
| Q |
170 |
aatg |
173 |
Q |
| |
|
|||| |
|
|
| T |
37953885 |
aatg |
37953888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #93
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 75 - 184
Target Start/End: Complemental strand, 3673962 - 3673855
Alignment:
| Q |
75 |
ctagctcagctggcaaaa-tgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatg |
173 |
Q |
| |
|
|||||||| ||||||||| |||||||||||||||| | |||||||||||| |||||||||| |||||| ||| |||||||||||||||||||||| |
|
|
| T |
3673962 |
ctagctcaactggcaaaaatgtcgaaattgttaggtcat---atgccatgaccgtggttcgaaccgcggtaccaccaattgtgtgtgtgagtttataatg |
3673866 |
T |
 |
| Q |
174 |
gctttggcatt |
184 |
Q |
| |
|
||||| |||| |
|
|
| T |
3673865 |
actttgtcatt |
3673855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #94
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 63 - 157
Target Start/End: Complemental strand, 20990543 - 20990452
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgt |
157 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| ||| |||||||| | |||||| ||||||| |||||||||||| | |||||||||||||| |
|
|
| T |
20990543 |
tatccagaagttctagctcaactggcaaaatgccgacattgttag---gtcggatgtcatgaccagggttcgaaccccagaacctccacttgtgt |
20990452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #95
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 75 - 184
Target Start/End: Original strand, 35222283 - 35222387
Alignment:
| Q |
75 |
ctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatgg |
174 |
Q |
| |
|
|||||||| |||| |||||||||||||||||||| ||| || ||||||||| ||||||||||| |||||||||||| | ||||| ||||| |||||| |
|
|
| T |
35222283 |
ctagctcaactggtaaaatgtcgaaattgttaggtcgg---ataccatgaccgaggttcgaaccccggtacctccact--tatgtgtaagtttgtaatgg |
35222377 |
T |
 |
| Q |
175 |
ctttggcatt |
184 |
Q |
| |
|
||||| |||| |
|
|
| T |
35222378 |
ctttgccatt |
35222387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #96
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 63 - 184
Target Start/End: Original strand, 23554868 - 23554986
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||| | |||||||| |||| |||||| |||||||||||| || ||| ||||| | ||||||| ||||||||||||||||||||| ||||| |
|
|
| T |
23554868 |
tatccagaaatcctagctcaactggtaaaatgccgaaattgttagatcga---atgtcatgatcagggttcggaccctggtacctccacttgtgcgtgtg |
23554964 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
| |||||||||| |||| |||| |
|
|
| T |
23554965 |
aatttataatggttttgccatt |
23554986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #97
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 63 - 184
Target Start/End: Complemental strand, 24242028 - 24241910
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| ||||||| |||| |||||| ||||||||||| | ||||||||||| ||| |||||||| | |||| ||||||||||||||||| |
|
|
| T |
24242028 |
tatccagaagtcatagctcaactggtaaaatgcagaaattgttag---gttggatgccatgatcggagttcgaactccggtatctccacttgtgtgtgtg |
24241932 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
| ||||||||| ||||| |||| |
|
|
| T |
24241931 |
aatttataatgactttgtcatt |
24241910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #98
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 96 - 184
Target Start/End: Original strand, 29158829 - 29158919
Alignment:
| Q |
96 |
cgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttg-----tgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||| || |||||| |||||||||||||| |||||||||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
29158829 |
cgaaattgttaggccgg---ataccatgatcggggttcgaaccccggtacctccacttgtattttgtgtgtgagtttataatggctttgccatt |
29158919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #99
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 64 - 145
Target Start/End: Original strand, 43820867 - 43820945
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtac |
145 |
Q |
| |
|
|||||||||| ||| |||| ||||||||||| |||||||||||||| |||||||||||| |||||||||||||| ||||| |
|
|
| T |
43820867 |
atccagaagtcctaactcaactggcaaaatgccgaaattgttaggc---cggatgccatgatcggggttcgaaccccggtac |
43820945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #100
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 64 - 184
Target Start/End: Complemental strand, 11098203 - 11098086
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| ||| |||| ||| |||||| |||||||||||||| || ||| |||||| ||||||||||||| ||| || |||||| | ||||||| |
|
|
| T |
11098203 |
atccagaagtcctaactcaactgacaaaatatcgaaattgttaggtcga---atgtcatgactggggttcgaaccccggttccaccacttatatgtgtga |
11098107 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||| |||||| |||| |
|
|
| T |
11098106 |
gtttataattgctttgtcatt |
11098086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #101
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 122 - 172
Target Start/End: Original strand, 33286337 - 33286387
Alignment:
| Q |
122 |
tgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataat |
172 |
Q |
| |
|
|||||||||||||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
33286337 |
tgaccggggttcgaaccccggcacctccacttgtgtgtgtgagtttataat |
33286387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #102
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 76 - 184
Target Start/End: Complemental strand, 36372140 - 36372035
Alignment:
| Q |
76 |
tagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggc |
175 |
Q |
| |
|
||||||| ||||||||||| ||||||||||||||||| || |||||| ||||||||||||| | ||||||||||| | ||||||| ||||||| || |
|
|
| T |
36372140 |
tagctcaactggcaaaatgccgaaattgttaggccgg---atatcatgactggggttcgaaccccgatacctccacttatatgtgtgaatttataacagc |
36372044 |
T |
 |
| Q |
176 |
tttggcatt |
184 |
Q |
| |
|
|||| |||| |
|
|
| T |
36372043 |
tttgtcatt |
36372035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #103
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 70 - 184
Target Start/End: Original strand, 1766713 - 1766827
Alignment:
| Q |
70 |
aagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctc---cacttgtgtgtgtgagtt |
166 |
Q |
| |
|
|||| |||||||| || |||||||| |||||||||||| ||| |||| |||||| ||||||||||| |||||||| ||||||||||||| |||| |
|
|
| T |
1766713 |
aagtcctagctcaattgtcaaaatgttgaaattgttaggtcgg---atgctgtgaccgaggttcgaaccccggtacctcctccacttgtgtgtgtaagtt |
1766809 |
T |
 |
| Q |
167 |
tataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||| |||| |
|
|
| T |
1766810 |
tataatggctttgccatt |
1766827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #104
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 97 - 172
Target Start/End: Original strand, 11565032 - 11565104
Alignment:
| Q |
97 |
gaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataat |
172 |
Q |
| |
|
|||||||||||||||| |||| |||||||| |||||||| | ||||||||||||||||||| |||||||||||| |
|
|
| T |
11565032 |
gaaattgttaggccgg---atgctatgaccggagttcgaactccggtacctccacttgtgtgtttgagtttataat |
11565104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #105
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 64 - 171
Target Start/End: Complemental strand, 17649970 - 17649867
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||| | |||||||| |||||||||| ||||||||||| ||||| ||| ||||| |||| ||||||||| ||||||||||||| || |||||| |
|
|
| T |
17649970 |
atccagaaatcctagctcaactggcaaaataccgaaattgttaagccgg---atgtcatgatcggg-ttcgaaccccggtacctccacttatgcgtgtga |
17649875 |
T |
 |
| Q |
164 |
gtttataa |
171 |
Q |
| |
|
|||||||| |
|
|
| T |
17649874 |
gtttataa |
17649867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #106
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 89 - 184
Target Start/End: Original strand, 45406347 - 45406439
Alignment:
| Q |
89 |
aaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||| ||||||||||||||||| ||| ||||| |||||||||||| | ||||| |||||| |||||||| |||||||||||||||| |||| |
|
|
| T |
45406347 |
aaaatgccgaaattgttaggccgg---atgtcatgatcggggttcgaactccagtaccaccacttatgtgtgtgggtttataatggctttgccatt |
45406439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #107
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 64 - 162
Target Start/End: Complemental strand, 3728455 - 3728360
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
|||||||||| | |||||| ||| |||||| |||||||||||||| ||| ||| ||||| ||||||||||||| | |||||||||||||||||||| |
|
|
| T |
3728455 |
atccagaagtcccagctcaactgacaaaatatcgaaattgttaggtcgg---atgtcatgattggggttcgaaccccgatacctccacttgtgtgtgtg |
3728360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #108
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 63 - 184
Target Start/End: Original strand, 15129635 - 15129750
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| |||||||| | ||||||||| | |||||||||| | | |||||||||| || |||||||| ||| ||||||||||| |||||||| |
|
|
| T |
15129635 |
tatccagaagtcctagctcaaccggcaaaatgccaaaattgttag---gtctgatgccatgatcgaggttcgaa-cctcgtacctccact--tgtgtgtg |
15129728 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||| |||||| |||| |
|
|
| T |
15129729 |
agtttataatagctttgtcatt |
15129750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #109
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 120 - 172
Target Start/End: Complemental strand, 35058932 - 35058880
Alignment:
| Q |
120 |
catgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataat |
172 |
Q |
| |
|
||||| ||| ||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
35058932 |
catgatcggagttcgaaccctagtacctccacttgtgtgtgtgagtttataat |
35058880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #110
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 64 - 178
Target Start/End: Original strand, 42650167 - 42650278
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
||||| |||| ||| |||| | || |||||| ||||||||||||| ||| ||||||||| |||||||||||| ||||||||||||| ||||| ||| |
|
|
| T |
42650167 |
atccacaagtcctaactcaaccggtaaaatgccgaaattgttaggtcgg---atgccatgattggggttcgaacctcggtacctccacttatgtgtatga |
42650263 |
T |
 |
| Q |
164 |
gtttataatggcttt |
178 |
Q |
| |
|
|||||||||| |||| |
|
|
| T |
42650264 |
gtttataatgacttt |
42650278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #111
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 129 - 184
Target Start/End: Original strand, 7882917 - 7882972
Alignment:
| Q |
129 |
ggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||| ||||||||| ||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
7882917 |
ggttcgaactctggtaccttcacttatgtgtgtgagtttataatggctttgccatt |
7882972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #112
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 22762003 - 22762121
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacct-ccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||||||| ||| ||| ||||||| |||||||||||| | |||||| ||||| || ||||||||| ||||||| |||||||||||| | |
|
|
| T |
22762003 |
atccagaagttctagttcaactgacaaaatgccgaaattgttag---gtcggatgtcatgatcgaagttcgaacctcggtacctaccacttgtgtgtata |
22762099 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||| ||||| |||| |
|
|
| T |
22762100 |
agtttataatgtctttgtcatt |
22762121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #113
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 70 - 184
Target Start/End: Original strand, 40216783 - 40216897
Alignment:
| Q |
70 |
aagttctagctcagctggcaaaa-tgtcgaaa-ttgttaggccggcggatgccatgaccggggttcgaaccctggtacctccactt-gtgtgtgtgagtt |
166 |
Q |
| |
|
|||| |||||||| ||||||||| || ||||| |||||||||||| ||| | ||| ||||||||||| ||||| |||||||||| ||||||||||||| |
|
|
| T |
40216783 |
aagtcctagctcaactggcaaaaatgccgaaaattgttaggccgg---atgtcttgatcggggttcgaatcctggcacctccactttgtgtgtgtgagtt |
40216879 |
T |
 |
| Q |
167 |
tataatggctttggcatt |
184 |
Q |
| |
|
||| ||||||||| |||| |
|
|
| T |
40216880 |
tatgatggctttgtcatt |
40216897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #114
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 63 - 178
Target Start/End: Original strand, 2527200 - 2527310
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| ||||||| |||||||||| | ||||||||| ||||| ||||||| || |||||||||| || |||||||||||| | |||||| |
|
|
| T |
2527200 |
tatccagaagtcttagctcaactggcaaaatcccaaaattgttaagccgg---atgccataactggggttcgaatcccggtacctccact--tatgtgtg |
2527294 |
T |
 |
| Q |
163 |
agtttataatggcttt |
178 |
Q |
| |
|
||||||||||| |||| |
|
|
| T |
2527295 |
agtttataatgacttt |
2527310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #115
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 59 - 153
Target Start/End: Complemental strand, 29845219 - 29845128
Alignment:
| Q |
59 |
tttatatccagaagttctagctcagctggcaaaa-tgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccactt |
153 |
Q |
| |
|
||||||||||||||| |||| ||| ||||||||| | ||||||||||||||| ||||||||||| ||||||||||||||| ||| ||||||| |
|
|
| T |
29845219 |
tttatatccagaagtcctagttcaactggcaaaaatatcgaaattgttaggc----ggatgccatgatcggggttcgaaccctaatacatccactt |
29845128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #116
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 76 - 160
Target Start/End: Complemental strand, 38017291 - 38017210
Alignment:
| Q |
76 |
tagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtg |
160 |
Q |
| |
|
||||||| |||| |||||| ||||||| ||| ||||| ||| |||||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
38017291 |
tagctcaactggaaaaatgccgaaattattaagccgg---atgtcatgacgggggttcgaaccccggtacctccacttgtgtgtg |
38017210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #117
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 76 - 184
Target Start/End: Original strand, 41278612 - 41278717
Alignment:
| Q |
76 |
tagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggc |
175 |
Q |
| |
|
||||||| |||||||||| | |||||||||||| || |||| ||||| || |||||||||| | ||||||||||| ||||||||||||| |||||| |
|
|
| T |
41278612 |
tagctcaactggcaaaataccaaaattgttaggctgg---atgctatgactggagttcgaaccccgatacctccacttttgtgtgtgagtttttaatggt |
41278708 |
T |
 |
| Q |
176 |
tttggcatt |
184 |
Q |
| |
|
|||| |||| |
|
|
| T |
41278709 |
tttgccatt |
41278717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #118
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 65 - 184
Target Start/End: Complemental strand, 41746776 - 41746662
Alignment:
| Q |
65 |
tccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgag |
164 |
Q |
| |
|
||||||||| |||||||| ||| ||||||| | ||||| ||||||||| ||||||||| |||||||||||| ||||| | |||||| || ||||||| |
|
|
| T |
41746776 |
tccagaagtcctagctcaactgacaaaatgccaaaattattaggccgg---atgccatgatcggggttcgaactctggtccttccact--tgcgtgtgag |
41746682 |
T |
 |
| Q |
165 |
tttataatggctttggcatt |
184 |
Q |
| |
|
||||||| | ||||| |||| |
|
|
| T |
41746681 |
tttataaagactttgtcatt |
41746662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #119
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 78 - 172
Target Start/End: Complemental strand, 5682338 - 5682244
Alignment:
| Q |
78 |
gctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccac---ttgtgtgtgtgagtttataat |
172 |
Q |
| |
|
||||| || ||||||||| ||||||||||||| |||||| |||||||| |||||||||| | ||||||||| ||||||||||||||||||||| |
|
|
| T |
5682338 |
gctcaactagcaaaatgttgaaattgttaggc---cggatgttatgaccggagttcgaaccccgatacctccactaattgtgtgtgtgagtttataat |
5682244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #120
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 122 - 178
Target Start/End: Complemental strand, 28183785 - 28183728
Alignment:
| Q |
122 |
tgaccggggttcgaaccctggtacctccactt-gtgtgtgtgagtttataatggcttt |
178 |
Q |
| |
|
|||||||||||||||||| | |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
28183785 |
tgaccggggttcgaaccccgacacctccactttgtgtgtgtgagtttataatggcttt |
28183728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #121
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 64 - 179
Target Start/End: Complemental strand, 38216884 - 38216772
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| ||| ||| ||| |||||| ||||||||||||||| | ||| |||||||||||||| ||| | | || |||||||| ||||||||| |
|
|
| T |
38216884 |
atccagaagtcttagttcaactgaaaaaatgccgaaattgttaggccag---atgtcatgaccggggttcaaactccgataactccacttatgtgtgtga |
38216788 |
T |
 |
| Q |
164 |
gtttataatggctttg |
179 |
Q |
| |
|
|||||||||| ||||| |
|
|
| T |
38216787 |
gtttataatgactttg |
38216772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #122
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 115 - 184
Target Start/End: Original strand, 43167186 - 43167255
Alignment:
| Q |
115 |
gatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||| ||||| |||||||||||||| | |||||||||||| |||||| |||||||||||| |||| |||| |
|
|
| T |
43167186 |
gatgtcatgatcggggttcgaaccccgatacctccacttgcgtgtgtcagtttataatggttttgtcatt |
43167255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #123
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 70 - 172
Target Start/End: Complemental strand, 7432618 - 7432519
Alignment:
| Q |
70 |
aagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttat |
169 |
Q |
| |
|
|||| |||||||| ||||||||||| ||||||||||| |||| | | ||||| |||| ||||||| ||||||||||||||| ||||| ||| ||||| |
|
|
| T |
7432618 |
aagtcctagctcaactggcaaaatgccgaaattgttaaaccgg---acgtcatgatcgggattcgaactctggtacctccacttatgtgtatgaatttat |
7432522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #124
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 89 - 178
Target Start/End: Complemental strand, 10926190 - 10926104
Alignment:
| Q |
89 |
aaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggcttt |
178 |
Q |
| |
|
|||||| ||||||||||||| ||| |||| ||||||||| |||||| || ||||||||| || ||||||||| |||||||||||||| |
|
|
| T |
10926190 |
aaaatgccgaaattgttaggtcgg---atgctatgaccgggattcgaatcccagtacctccatttatgtgtgtgaatttataatggcttt |
10926104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #125
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 89 - 177
Target Start/End: Original strand, 11021361 - 11021447
Alignment:
| Q |
89 |
aaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccac-ttgtgtgtgtgagtttataatggctt |
177 |
Q |
| |
|
|||||||||||||| ||||| ||| | | ||||||| | |||||||||| ||||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
11021361 |
aaaatgtcgaaattattaggtcgg---acgtcatgacctgagttcgaaccccggtacctccactttgtgtgtgtgagtttatgatggctt |
11021447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #126
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 142 - 177
Target Start/End: Complemental strand, 11407296 - 11407261
Alignment:
| Q |
142 |
gtacctccacttgtgtgtgtgagtttataatggctt |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
11407296 |
gtacctccacttgtgtgtgtgagtttataatggctt |
11407261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #127
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 136 - 179
Target Start/End: Complemental strand, 43748861 - 43748818
Alignment:
| Q |
136 |
accctggtacctccacttgtgtgtgtgagtttataatggctttg |
179 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
43748861 |
accccggtacctccacttgtgtgtgtgagtttataatgactttg |
43748818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #128
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 89 - 184
Target Start/End: Original strand, 14258328 - 14258417
Alignment:
| Q |
89 |
aaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||| |||||||||||| ||| |||| ||||||||||||||||| | |||||||||||| | ||||||||||||||||| ||||| |||| |
|
|
| T |
14258328 |
aaaatgttgaaattgttaggtcgg---atgctatgaccggggttcgaacac-ggtacctccact--tatgtgtgagtttataatgactttgtcatt |
14258417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #129
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 119 - 173
Target Start/End: Original strand, 42158610 - 42158664
Alignment:
| Q |
119 |
ccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatg |
173 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
42158610 |
ccatgaccaaggttcgaacctcggtacctccacttatgtgtgtgagtttataatg |
42158664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #130
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 89 - 184
Target Start/End: Original strand, 8971829 - 8971921
Alignment:
| Q |
89 |
aaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||| ||||||||| ||||| ||| ||||||| |||| ||| |||||||||| ||||||||||||||| |||| |||| ||||| |||| |
|
|
| T |
8971829 |
aaaatgtcaaaattgttaagccgg---atgttatgaccgaggtttgaatcctggtaccttcacttgtgtgtgtgaatttacaatgactttgccatt |
8971921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #131
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 86 - 184
Target Start/End: Complemental strand, 43105985 - 43105891
Alignment:
| Q |
86 |
ggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||| |||||||||||||||| ||| |||||| |||||||||||| ||| | || |||||||||||||||||||||| ||||| |||| |
|
|
| T |
43105985 |
ggcaaaatgccgaaattgttaggccg----atgttatgaccagggttcgaaccccaatactttcatttgtgtgtgtgagtttataatgactttgtcatt |
43105891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #132
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 113 - 184
Target Start/End: Complemental strand, 14138865 - 14138797
Alignment:
| Q |
113 |
cggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||| |||||| || |||| ||||| ||||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
14138865 |
cggataccatgatcgtggtttgaacc-tggtacctccacttgtgtgtg--agtttataatggctttgtcatt |
14138797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #133
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 114 - 153
Target Start/End: Original strand, 1258758 - 1258797
Alignment:
| Q |
114 |
ggatgccatgaccggggttcgaaccctggtacctccactt |
153 |
Q |
| |
|
||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
1258758 |
ggatgccatgaccagggttcgaaccctgatacctccactt |
1258797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #134
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 64 - 161
Target Start/End: Complemental strand, 11265185 - 11265091
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgt |
161 |
Q |
| |
|
|||||||||| |||| ||| ||| ||||||||| |||||||||||| |||||||| ||| ||| ||| ||| | ||||||||||||| ||||||| |
|
|
| T |
11265185 |
atccagaagtcctagttcaactgacaaaatgtcaaaattgttaggc---cggatgccgtgatcggaattcaaactccggtacctccacttatgtgtgt |
11265091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #135
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 56 - 173
Target Start/End: Complemental strand, 36482193 - 36482080
Alignment:
| Q |
56 |
taatttatatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgt |
155 |
Q |
| |
|
|||||| ||||||||||| ||||| | ||| ||||||||||||||||||||| || |||| |||| |||||||||||| | | | |||||| || | |
|
|
| T |
36482193 |
taatttttatccagaagtcttagcttaactgataaaatgtcgaaattgttaggc---cgaatgctatgatcggggttcgaactccgatgcctcca-tttt |
36482098 |
T |
 |
| Q |
156 |
gtgtgtgagtttataatg |
173 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
36482097 |
atgtgtgagtttataatg |
36482080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #136
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 67 - 172
Target Start/End: Original strand, 41897826 - 41897928
Alignment:
| Q |
67 |
cagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtt |
166 |
Q |
| |
|
||||||| ||| |||| ||| |||||| ||||||||||||||||| ||| ||| || ||| ||| ||||| | ||| ||||||| |||||||||||| |
|
|
| T |
41897826 |
cagaagtcctaactcaactgacaaaataccgaaattgttaggccgg---atgtcataactgggattcaaaccccgatacttccacttatgtgtgtgagtt |
41897922 |
T |
 |
| Q |
167 |
tataat |
172 |
Q |
| |
|
|||||| |
|
|
| T |
41897923 |
tataat |
41897928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #137
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 118 - 184
Target Start/End: Complemental strand, 12927304 - 12927239
Alignment:
| Q |
118 |
gccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||| | |||||||||| | ||||| ||||||||||||| ||||||||||||| ||||| |||| |
|
|
| T |
12927304 |
gccatgatcagggttcgaactccggtacatccacttgtgtgt-tgagtttataatgactttgccatt |
12927239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #138
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 124 - 174
Target Start/End: Complemental strand, 13403490 - 13403441
Alignment:
| Q |
124 |
accggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatgg |
174 |
Q |
| |
|
||||| |||||||||| ||||||||||||| ||||||||||||||| |||| |
|
|
| T |
13403490 |
accggagttcgaaccccggtacctccactt-tgtgtgtgagtttatgatgg |
13403441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #139
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 85 - 145
Target Start/End: Complemental strand, 31261063 - 31261006
Alignment:
| Q |
85 |
tggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtac |
145 |
Q |
| |
|
||||||||||||||||||||||| | |||| ||||||| |||||||||||||| ||||| |
|
|
| T |
31261063 |
tggcaaaatgtcgaaattgttag---gtcggacgccatgatcggggttcgaaccccggtac |
31261006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #140
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 120 - 169
Target Start/End: Complemental strand, 33128241 - 33128191
Alignment:
| Q |
120 |
catgaccggggttcgaaccctggtacctccac-ttgtgtgtgtgagtttat |
169 |
Q |
| |
|
||||| |||||||||||||| ||||||||||| |||||| ||||||||||| |
|
|
| T |
33128241 |
catgatcggggttcgaaccccggtacctccactttgtgtatgtgagtttat |
33128191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #141
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 130 - 174
Target Start/End: Original strand, 1007189 - 1007232
Alignment:
| Q |
130 |
gttcgaaccctggtacctccacttgtgtgtgtgagtttataatgg |
174 |
Q |
| |
|
|||||||||| |||||||||| || |||||||||||||||||||| |
|
|
| T |
1007189 |
gttcgaaccccggtacctccagtt-tgtgtgtgagtttataatgg |
1007232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 88; Significance: 3e-42; HSPs: 81)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 63 - 184
Target Start/End: Complemental strand, 8448272 - 8448154
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| |||||||| ||||||||||| ||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
8448272 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccgg---atgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtg |
8448176 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
8448175 |
agtttataatggctttgccatt |
8448154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 63 - 184
Target Start/End: Complemental strand, 8457076 - 8456958
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| |||||||| ||||||||||| ||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
8457076 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccgg---atgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtg |
8456980 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
8456979 |
agtttataatggctttgccatt |
8456958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 67 - 184
Target Start/End: Complemental strand, 18861893 - 18861779
Alignment:
| Q |
67 |
cagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtt |
166 |
Q |
| |
|
||||||| |||||||| ||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18861893 |
cagaagtcctagctcaactggcaaaatgccgaaattgttaggccgg---atgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtt |
18861797 |
T |
 |
| Q |
167 |
tataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||| |||| |
|
|
| T |
18861796 |
tataatggctttgccatt |
18861779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 84; E-Value: 7e-40
Query Start/End: Original strand, 59 - 184
Target Start/End: Complemental strand, 31205317 - 31205195
Alignment:
| Q |
59 |
tttatatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtg |
158 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||| ||||||||||||||||| ||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
31205317 |
tttatatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccgg---atgccatgatcggggttcgaaccccagtacctccacttgtgtg |
31205221 |
T |
 |
| Q |
159 |
tgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||||||| |||| |
|
|
| T |
31205220 |
tgtgagtttataatggctttgccatt |
31205195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 63 - 184
Target Start/End: Original strand, 8939624 - 8939742
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| |||||||| ||||||||||| ||||||||||||| ||| ||| |||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
8939624 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggtcgg---atgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtg |
8939720 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
8939721 |
agtttataatggctttgccatt |
8939742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 79; E-Value: 7e-37
Query Start/End: Original strand, 68 - 184
Target Start/End: Original strand, 2958996 - 2959109
Alignment:
| Q |
68 |
agaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagttt |
167 |
Q |
| |
|
|||||||||| ||| |||| |||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
2958996 |
agaagttctaattcaactggtaaaatgtcgaaattgttaggccgg---atgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
2959092 |
T |
 |
| Q |
168 |
ataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||| |||| |
|
|
| T |
2959093 |
ataatggctttgccatt |
2959109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 79; E-Value: 7e-37
Query Start/End: Original strand, 64 - 184
Target Start/End: Complemental strand, 5603576 - 5603459
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
||||||||||||||||||| |||| |||||| ||||||| ||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
5603576 |
atccagaagttctagctcaactggaaaaatgccgaaattattaggccgg---atgccatgaccggggttcgaaccctgatacctccacttgtgtgtgtga |
5603480 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||| ||||| |||| |
|
|
| T |
5603479 |
gtttataatgactttgccatt |
5603459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 79; E-Value: 7e-37
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 7098805 - 7098922
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| |||| |||||||||||||||||||||||| |||||||||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
7098805 |
atccagaagtcctagctcaactggtaaaatgtcgaaattgttaggccgg---atgccatgactagggttcgaaccttggtacctccacttgtgtgtgtga |
7098901 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
7098902 |
gtttataatggctttgccatt |
7098922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 79; E-Value: 7e-37
Query Start/End: Original strand, 64 - 184
Target Start/End: Complemental strand, 8329687 - 8329570
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
||||| |||| |||||||| ||||||| ||| ||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8329687 |
atccaaaagtcctagctcaactggcaatatgccgaaattgttaggccgg---atgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtga |
8329591 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
8329590 |
gtttataatggctttgccatt |
8329570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 63 - 184
Target Start/End: Original strand, 735443 - 735559
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||| |||||||||||||| |||||||||||| |||||||| |
|
|
| T |
735443 |
tatccagaagttctagctcaactggcaaaatgccgaaattgttaggc---cggatgccatgatcggggttcgaaccccggtacctccact--tgtgtgtg |
735537 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
735538 |
agtttataatggctttgccatt |
735559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 62 - 184
Target Start/End: Original strand, 1241592 - 1241711
Alignment:
| Q |
62 |
atatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgt |
161 |
Q |
| |
|
|||| ||||||| |||||||| ||||||||||| ||||||||||||||||| ||| |||||||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
1241592 |
atattcagaagtcctagctcaactggcaaaatgccgaaattgttaggccgg---atgtcatgaccggggttcgaaccccgctacctccacttgtgtgtgt |
1241688 |
T |
 |
| Q |
162 |
gagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||||| |||| |
|
|
| T |
1241689 |
gagtttataatggctttgccatt |
1241711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 55 - 184
Target Start/End: Complemental strand, 13507448 - 13507322
Alignment:
| Q |
55 |
ttaatttatatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttg |
154 |
Q |
| |
|
|||||| |||||||||||| |||||||| |||| |||||| |||||||||||||| || ||||||||||||| |||||||||| | |||||||||||| |
|
|
| T |
13507448 |
ttaattgatatccagaagtcctagctcaactgggaaaatgccgaaattgttaggctgg---atgccatgaccggtgttcgaaccccgatacctccacttg |
13507352 |
T |
 |
| Q |
155 |
tgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||||||||||| |||| |
|
|
| T |
13507351 |
tgtgtgtgagtttataatggctttgccatt |
13507322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 60 - 184
Target Start/End: Complemental strand, 17534656 - 17534534
Alignment:
| Q |
60 |
ttatatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgt |
159 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||||| ||||||||||||||||| ||| |||||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
17534656 |
ttatatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccgg---atgtcatgaccggggttcgaaccccggtgcctccacttgtgtgt |
17534560 |
T |
 |
| Q |
160 |
gtgag-tttataatggctttggcatt |
184 |
Q |
| |
|
||||| ||||||||||||||| |||| |
|
|
| T |
17534559 |
gtgagttttataatggctttgtcatt |
17534534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 4083586 - 4083703
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| ||||||||||| ||||||||||||| ||| |||||||||||||||||||||| | |||||||||||||||||| |||| |
|
|
| T |
4083586 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggtcgg---atgccatgaccggggttcgaacaccggtacctccacttgtgtgcgtga |
4083682 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
4083683 |
gtttataatggctttgccatt |
4083703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 10181044 - 10181161
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| ||||||||||| ||||||||||||| ||| ||| | ||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10181044 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggtcgg---atgtcgtgatcggggttcgaaccctggtacctccacttgtgtgtgtga |
10181140 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
10181141 |
gtttataatggctttgccatt |
10181161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 61 - 184
Target Start/End: Original strand, 4480470 - 4480590
Alignment:
| Q |
61 |
tatatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtg |
160 |
Q |
| |
|
||||||||||||| ||| |||| ||||||||||| ||||||||||||||||| ||||||||| ||||||||||||| | |||||||||||||||||| |
|
|
| T |
4480470 |
tatatccagaagtcctaactcaactggcaaaatgccgaaattgttaggccgg---atgccatgattggggttcgaaccccgttacctccacttgtgtgtg |
4480566 |
T |
 |
| Q |
161 |
tgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||||| |||| |
|
|
| T |
4480567 |
tgagtttataatggctttgccatt |
4480590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 64 - 171
Target Start/End: Complemental strand, 10263200 - 10263096
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| |||||||| || ||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
10263200 |
atccagaagtcctagctcaactggcaaagtgccgaaattgttaggccgg---atgccatgaccggggttcgaaccctagtacctccacttgtgtgtgtga |
10263104 |
T |
 |
| Q |
164 |
gtttataa |
171 |
Q |
| |
|
|||||||| |
|
|
| T |
10263103 |
gtttataa |
10263096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 63 - 184
Target Start/End: Original strand, 6266630 - 6266748
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||| ||||| ||||||| |||||||||||||||||||||||| |||| ||| ||||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
6266630 |
tatccggaagtcttagctcaactggcaaaatgtcgaaattgttagaccgg---atgtcatgaccggagttcgaaccccggtacctccacttgtgtgtgtg |
6266726 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
6266727 |
agtttataatggctttgccatt |
6266748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 64 - 184
Target Start/End: Complemental strand, 2314728 - 2314609
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtg--tgt |
161 |
Q |
| |
|
|||||||||| |||||||| ||||||||||| ||||||||||||||||| ||| |||||||||||||||||||| |||||||||||||||||| ||| |
|
|
| T |
2314728 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccgg---atgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgt |
2314632 |
T |
 |
| Q |
162 |
gagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||| ||||| |||| |
|
|
| T |
2314631 |
gagtttataatgactttgccatt |
2314609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 64 - 179
Target Start/End: Original strand, 10531385 - 10531497
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
||||||||||||||||||| ||| |||||| |||||||||||||||||| |||| |||| |||||||||||||| ||||||||||||| | ||||||| |
|
|
| T |
10531385 |
atccagaagttctagctcaactgacaaaatatcgaaattgttaggccgg---atgctatgatcggggttcgaaccccggtacctccacttttatgtgtga |
10531481 |
T |
 |
| Q |
164 |
gtttataatggctttg |
179 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
10531482 |
gtttataatggctttg |
10531497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 67 - 184
Target Start/End: Complemental strand, 32107961 - 32107847
Alignment:
| Q |
67 |
cagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtt |
166 |
Q |
| |
|
||||||| |||||||| ||||||||||| |||||||||||||| || ||| ||||| |||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
32107961 |
cagaagtcctagctcaactggcaaaatgccgaaattgttaggctgg---atgtcatgatcggggttcgaaccccggtacttccacttgtgtgtgtgagtt |
32107865 |
T |
 |
| Q |
167 |
tataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||| |||| |
|
|
| T |
32107864 |
tataatggctttgccatt |
32107847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 8374141 - 8374258
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||||||| |||| |||| |||||| |||||||||||||| || ||||||||| |||||||||||||||| ||||||||||| | ||||||| |
|
|
| T |
8374141 |
atccagaagttctaactcaactggtaaaatgccgaaattgttaggcggg---atgccatgatcggggttcgaaccctgatacctccacttatatgtgtga |
8374237 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
8374238 |
gtttataatggctttgtcatt |
8374258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 89 - 184
Target Start/End: Original strand, 1855030 - 1855122
Alignment:
| Q |
89 |
aaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
1855030 |
aaaatgtcgatattgttaggccgg---atgccatgatcggggttcgaaccccggtacctccacttgtgtgtgtgagtttataatggctttgccatt |
1855122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 63 - 184
Target Start/End: Complemental strand, 16496783 - 16496663
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaa-tgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgt |
161 |
Q |
| |
|
||||||||||| |||||||| ||||||||| || ||||||||||||||||| |||||||||||||||||||||||| ||| ||||||||| ||||||| |
|
|
| T |
16496783 |
tatccagaagtcctagctcaactggcaaaaatgccgaaattgttaggccgg---atgccatgaccggggttcgaaccccggtgcctccacttatgtgtgt |
16496687 |
T |
 |
| Q |
162 |
gag-tttataatggctttggcatt |
184 |
Q |
| |
|
||| ||||||||||||||| |||| |
|
|
| T |
16496686 |
gagttttataatggctttgccatt |
16496663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 63 - 184
Target Start/End: Original strand, 10330802 - 10330921
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaa-tgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgt |
161 |
Q |
| |
|
|||||| |||| |||||||| ||||||||| || | ||||||||||||| | ||||||||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
10330802 |
tatccacaagtcctagctcaactggcaaaaatgccaaaattgttaggccag---atgccatgaccggggatcgaaccccggtacctccacttgtgtgtgt |
10330898 |
T |
 |
| Q |
162 |
gagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||||| |||| |
|
|
| T |
10330899 |
gagtttataatggctttgccatt |
10330921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 64 - 184
Target Start/End: Complemental strand, 1686363 - 1686245
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| ||||||| ||| |||||| ||||||||||||||||| ||||||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1686363 |
atccagaagtcgtagctcaactgctaaaatgccgaaattgttaggccgg---atgccatgatcggggttcgaaccccggtacctccacttgtgtgtgtga |
1686267 |
T |
 |
| Q |
164 |
g-tttataatggctttggcatt |
184 |
Q |
| |
|
| ||||||||||||||| |||| |
|
|
| T |
1686266 |
gttttataatggctttgccatt |
1686245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 67 - 184
Target Start/End: Complemental strand, 12795145 - 12795031
Alignment:
| Q |
67 |
cagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtt |
166 |
Q |
| |
|
||||||| |||||||| || | |||||| ||||||||||||||||| ||| ||||||||||||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
12795145 |
cagaagtcctagctcaactagtaaaatgccgaaattgttaggccgg---atgtcatgaccggggttcgaaccgcggtacctccacttatgtgtgtgagtt |
12795049 |
T |
 |
| Q |
167 |
tataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||| |||| |
|
|
| T |
12795048 |
tataatggctttgccatt |
12795031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 63 - 184
Target Start/End: Original strand, 15953232 - 15953350
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| |||||||| |||| |||||| |||||||||||| ||| ||| ||||||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
15953232 |
tatccagaagtcctagctcaactggtaaaatgccgaaattgttagaccga---atgtaatgaccggggttcgaaccccggtacctccacttgtatgtgtg |
15953328 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
15953329 |
agtttataatggctttgtcatt |
15953350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 4996871 - 4996988
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| ||| ||||||| |||||||||||||||| ||||||||| ||||||||||| || |||||||||||||||||||||| |
|
|
| T |
4996871 |
atccagaagtcctagctcaactgacaaaatgctgaaattgttaggccgg---atgccatgatcggggttcgaatcccagtacctccacttgtgtgtgtga |
4996967 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||| |||||| |||| |
|
|
| T |
4996968 |
gtttataatagctttgccatt |
4996988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 96 - 184
Target Start/End: Original strand, 5660430 - 5660515
Alignment:
| Q |
96 |
cgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||| ||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
5660430 |
cgaaattgttaggccgg---atgccatgatcggggttcgaaccccggtacctccacttgtgtgtgtgagtttataatggctttgccatt |
5660515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 63 - 166
Target Start/End: Complemental strand, 28594201 - 28594101
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| ||| |||| ||||||||| ||||||||||||||||||| ||||||||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
28594201 |
tatccagaagtcctaactcaactggcaaaaggtcgaaattgttaggccgg---atgccatgatcggggttcgaacctcggtacctccacttgtgtgtgtg |
28594105 |
T |
 |
| Q |
163 |
agtt |
166 |
Q |
| |
|
|||| |
|
|
| T |
28594104 |
agtt |
28594101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 63 - 178
Target Start/End: Complemental strand, 32643858 - 32643742
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtg-- |
160 |
Q |
| |
|
||||||||||| ||| |||| |||| |||||| ||||||||||||||||| ||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
32643858 |
tatccagaagtcctaactcaactggtaaaatgccgaaattgttaggccgg---atgccatgaccggggttcgaatcccggtacctccacttgtgtgtgtg |
32643762 |
T |
 |
| Q |
161 |
--tgagtttataatggcttt |
178 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
32643761 |
tctgagtttataatggcttt |
32643742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 63 - 184
Target Start/End: Complemental strand, 13540291 - 13540173
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| |||||||| |||||||||| ||||||||||||||||| |||| ||||||||| || ||| || ||||| |||||||||||||||| |
|
|
| T |
13540291 |
tatccagaagtcctagctcaaatggcaaaatgccgaaattgttaggccgg---atgcaatgaccgggatttgaatcccggtacgtccacttgtgtgtgtg |
13540195 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||| |||| |||| |
|
|
| T |
13540194 |
agtttataatggttttgccatt |
13540173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 63 - 184
Target Start/End: Original strand, 31057830 - 31057948
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| ||||||| ||||| ||||| || ||||||| ||||| ||| |||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
31057830 |
tatccagaagtcatagctcaactggcgaaatgctgacattgttaagccgg---atgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtg |
31057926 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||| |||| |||| |
|
|
| T |
31057927 |
agtttataatggttttgtcatt |
31057948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 67 - 184
Target Start/End: Original strand, 21513074 - 21513190
Alignment:
| Q |
67 |
cagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccact--tgtgtgtgtgag |
164 |
Q |
| |
|
||||||| |||||||| |||||||||||||||||||||||||| |||||| ||||| ||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
21513074 |
cagaagtcctagctcaactggcaaaatgtcgaaattgttaggc---cggatgtcatgattggggttcgaaccccagtacctccacttgtgtgtgtgtgaa |
21513170 |
T |
 |
| Q |
165 |
tttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||| |||| |
|
|
| T |
21513171 |
tttataatggctttgccatt |
21513190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 89 - 184
Target Start/End: Original strand, 9727519 - 9727611
Alignment:
| Q |
89 |
aaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||||||||||| || |||||| |||||||||||||| |||||||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
9727519 |
aaaatgtcgaaattgttaggccgg---ataccatgatcggggttcgaacccctgtacctccacttgtgtgtgtgagtttataatgactttgtcatt |
9727611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 64 - 171
Target Start/End: Complemental strand, 14982783 - 14982679
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
||||| |||| |||||| | ||| |||||| ||||||||||||||||| ||||||| |||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
14982783 |
atccacaagtcctagcttaactgccaaaataccgaaattgttaggccgg---atgccataaccgaggttcgaaccctggtacctccacttgtgtgtgtga |
14982687 |
T |
 |
| Q |
164 |
gtttataa |
171 |
Q |
| |
|
|||||||| |
|
|
| T |
14982686 |
gtttataa |
14982679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 75 - 184
Target Start/End: Complemental strand, 2301497 - 2301390
Alignment:
| Q |
75 |
ctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgag-tttataatg |
173 |
Q |
| |
|
|||||||| ||||||||||| | ||||||||||| ||| ||| ||| |||||||||||||||| |||||||||||||||||||||||| ||||||||| |
|
|
| T |
2301497 |
ctagctcaactggcaaaatgccaaaattgttaggtcgg---atgtcataaccggggttcgaaccccggtacctccacttgtgtgtgtgagttttataatg |
2301401 |
T |
 |
| Q |
174 |
gctttggcatt |
184 |
Q |
| |
|
|||||| |||| |
|
|
| T |
2301400 |
gctttgccatt |
2301390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 76 - 184
Target Start/End: Complemental strand, 31747103 - 31746997
Alignment:
| Q |
76 |
tagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga-gtttataatgg |
174 |
Q |
| |
|
||||||| |||| |||||| ||||||||||||||||| ||||||||| |||||||||||||| ||||||| ||||| ||||||||| ||||||||||| |
|
|
| T |
31747103 |
tagctcaactggtaaaatgccgaaattgttaggccgg---atgccatgatcggggttcgaaccccggtaccttcacttatgtgtgtgaggtttataatgg |
31747007 |
T |
 |
| Q |
175 |
ctttggcatt |
184 |
Q |
| |
|
||||| |||| |
|
|
| T |
31747006 |
ctttgtcatt |
31746997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 29183657 - 29183774
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| ||| ||||| ||| ||||||||||||| |||||||||||||||||||||||| | || |||||||||||||||||| |
|
|
| T |
29183657 |
atccagaagtcctagctcaattggtaaaataccgacattgttaggccgg---atgccatgaccggggttcgaaccccgatatctccacttgtgtgtgtga |
29183753 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||| |||| |||| |||| |
|
|
| T |
29183754 |
gtttattatggttttgccatt |
29183774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 64 - 184
Target Start/End: Complemental strand, 34287300 - 34287183
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| ||| ||| ||||||||||| ||| ||||||||||||| |||||||||||||||||||||||| ||||| | ||||||||||| ||| |
|
|
| T |
34287300 |
atccagaagtcatagttcaactggcaaaatgccgacattgttaggccgg---atgccatgaccggggttcgaaccccggtactttcacttgtgtgtatga |
34287204 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||| |||| |||||| |||| |
|
|
| T |
34287203 |
gtttctaatagctttgccatt |
34287183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 75 - 178
Target Start/End: Complemental strand, 5626178 - 5626078
Alignment:
| Q |
75 |
ctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatgg |
174 |
Q |
| |
|
|||||||| |||| |||||| ||||||||||||| | ||| |||||| ||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
5626178 |
ctagctcaactggaaaaatgccgaaattgttaggtagt---atgtcatgactggggttcgaaccccggtacctccacttgtgtgtgtgagtttataatgg |
5626082 |
T |
 |
| Q |
175 |
cttt |
178 |
Q |
| |
|
|||| |
|
|
| T |
5626081 |
cttt |
5626078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 70 - 184
Target Start/End: Complemental strand, 6556606 - 6556495
Alignment:
| Q |
70 |
aagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttat |
169 |
Q |
| |
|
||||||||||||| ||| |||||| ||||||||||||||||| || | |||| |||||||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
6556606 |
aagttctagctcaattggtaaaatgccgaaattgttaggccgg---attctatgatcggggttcgaaccccggtacctccaattgtgtgtgtgagtttac |
6556510 |
T |
 |
| Q |
170 |
aatggctttggcatt |
184 |
Q |
| |
|
|||| ||||| |||| |
|
|
| T |
6556509 |
aatgactttgccatt |
6556495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 51 - 184
Target Start/End: Original strand, 29479415 - 29479546
Alignment:
| Q |
51 |
ataattaatttatatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctcca |
150 |
Q |
| |
|
|||||| |||| |||||| || | ||| |||| |||||||||||||||||||||||||| ||||| ||| |||||| ||||||||| | |||||||| |
|
|
| T |
29479415 |
ataatttatttttatccataactcctaactcaactggcaaaatgtcgaaattgttaggc---tggatgtcataaccgggattcgaaccccgatacctcca |
29479511 |
T |
 |
| Q |
151 |
cttgtgtgtgtgag-tttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||| ||||||||||||||| |||| |
|
|
| T |
29479512 |
gttgtgtgtgtgagttttataatggctttgtcatt |
29479546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 64 - 184
Target Start/End: Complemental strand, 31444420 - 31444304
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaa-tgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
|||||||||| |||||||| | ||||||| || ||||||||||||||||| ||||||||| ||||||||||||| |||||||||||| | |||||| |
|
|
| T |
31444420 |
atccagaagtcctagctcaaccggcaaaaatgccgaaattgttaggccggg---tgccatgactggggttcgaaccccggtacctccact--tatgtgtg |
31444326 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
31444325 |
agtttataatggctttgccatt |
31444304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 89 - 184
Target Start/End: Complemental strand, 35164711 - 35164617
Alignment:
| Q |
89 |
aaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtg--tgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||| |||||||||||||||| |||||||||||||||||||||| | ||| |||||||||||||| ||||||||||||||||||||| |||| |
|
|
| T |
35164711 |
aaaatgttgaaattgttaggccgg---atgccatgaccggggttcgaacaccggttcctccacttgtgtgtgtgtgagtttataatggctttgtcatt |
35164617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 63 - 184
Target Start/End: Complemental strand, 8116876 - 8116758
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
|||||| |||| |||||| | |||||||||| |||||||||||||||||| ||||| ||| ||| |||||||||| | ||| || ||||||||||||| |
|
|
| T |
8116876 |
tatccacaagtcctagcttaactggcaaaatatcgaaattgttaggccgg---atgccgtgatcggagttcgaaccccgatacttctacttgtgtgtgtg |
8116780 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||| |||||| |||| |
|
|
| T |
8116779 |
agtttataatagctttgccatt |
8116758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 76 - 184
Target Start/End: Original strand, 8977165 - 8977271
Alignment:
| Q |
76 |
tagctcagctggcaaaa-tgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatgg |
174 |
Q |
| |
|
||||||| ||||||||| || | ||||||||||||||| ||| ||||| |||||||||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
8977165 |
tagctcaactggcaaaaatgcccaaattgttaggccgg---atgtcatgatcggggttcgaaccccggtacctccatttgtgtgtgtgagtttataatgg |
8977261 |
T |
 |
| Q |
175 |
ctttggcatt |
184 |
Q |
| |
|
|||| |||| |
|
|
| T |
8977262 |
ttttgccatt |
8977271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 113 - 184
Target Start/End: Original strand, 34539337 - 34539408
Alignment:
| Q |
113 |
cggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||||||||||| || ||||||||||||| |||||||||||||||||| |||||| |||| |
|
|
| T |
34539337 |
cggatgccatgaccggggttcgaaacccggtacctccacttatgtgtgtgagtttataatagctttgtcatt |
34539408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #50
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 4891007 - 4891124
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| ||||||| |||| |||||| ||||||||||||||| | ||| ||||||||||||| ||| | | ||||||||||| ||||||||| |
|
|
| T |
4891007 |
atccagaagtcttagctcaactggaaaaatgccgaaattgttaggccag---atgtcatgaccggggtttgaatctcgatacctccacttatgtgtgtga |
4891103 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
4891104 |
gtttataatggctttgccatt |
4891124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #51
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 89 - 169
Target Start/End: Complemental strand, 9949255 - 9949178
Alignment:
| Q |
89 |
aaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttat |
169 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||| |||||||||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
9949255 |
aaaatgccgaaattgttaggccgg---atgccatgatcggggttcgaaccccggtacctccacttgtgtgtgtgaatttat |
9949178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #52
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 68 - 184
Target Start/End: Complemental strand, 24571742 - 24571629
Alignment:
| Q |
68 |
agaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagttt |
167 |
Q |
| |
|
|||||| |||||||| ||| |||||||||||||||||||||| | ||| ||||||| |||||||||||| | | ||||||||||||||||| ||||| |
|
|
| T |
24571742 |
agaagtcctagctcaactgaaaaaatgtcgaaattgttaggccag---atgtcatgaccagggttcgaaccccgttccctccacttgtgtgtgtaagttt |
24571646 |
T |
 |
| Q |
168 |
ataatggctttggcatt |
184 |
Q |
| |
|
|||||| ||||| |||| |
|
|
| T |
24571645 |
ataatgactttgtcatt |
24571629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #53
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 62 - 179
Target Start/End: Complemental strand, 2018894 - 2018779
Alignment:
| Q |
62 |
atatccagaagttctagctcagctggcaaaa-tgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtg |
160 |
Q |
| |
|
|||||||||||| |||||||| |||| |||| |||||||||||||||| | ||| |||||||| ||||||||| ||| |||||||||||||||||| |
|
|
| T |
2018894 |
atatccagaagtcctagctcaactggtaaaaatgtcgaaattgttaggtcaa---atgtcatgaccgtggttcgaactctgctacctccacttgtgtgtg |
2018798 |
T |
 |
| Q |
161 |
tgagtttataatggctttg |
179 |
Q |
| |
|
| ||||||||||| ||||| |
|
|
| T |
2018797 |
taagtttataatgactttg |
2018779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #54
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 113 - 184
Target Start/End: Original strand, 659199 - 659270
Alignment:
| Q |
113 |
cggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||| |||||||||||||| ||||| |||||||| |||||||||||||| ||||||||||||||| |||| |
|
|
| T |
659199 |
cggatgtcatgaccggggttcaaaccccggtacctctacttgtgtgtgtgaatttataatggctttgccatt |
659270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #55
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 27866587 - 27866705
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| | |||||| |||||||||| | ||||||||||||||| ||||||||| |||||||||||||| |||||| |||||||||||||| |
|
|
| T |
27866587 |
atccagaagtcccagctcaattggcaaaatgccaaaattgttaggccgg---atgccatgatcggggttcgaaccccaatacctctacttgtgtgtgtga |
27866683 |
T |
 |
| Q |
164 |
g-tttataatggctttggcatt |
184 |
Q |
| |
|
| ||||||||| ||||| |||| |
|
|
| T |
27866684 |
gttttataatgtctttgtcatt |
27866705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #56
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 113 - 179
Target Start/End: Original strand, 11152562 - 11152628
Alignment:
| Q |
113 |
cggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttg |
179 |
Q |
| |
|
|||||||||||||||||||||||| || ||||| |||||||||||||||||||||| ||| |||||| |
|
|
| T |
11152562 |
cggatgccatgaccggggttcgaatcccggtacatccacttgtgtgtgtgagtttacaatagctttg |
11152628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #57
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 62 - 184
Target Start/End: Complemental strand, 30615043 - 30614926
Alignment:
| Q |
62 |
atatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgt |
161 |
Q |
| |
|
|||| ||||||| |||| ||| ||||||||||||||||||||||||| |||||||||||| |||||||||| | | |||||||||| ||||||| |
|
|
| T |
30615043 |
atattcagaagtcctagttcaattggcaaaatgtcgaaattgttaggc---tggatgccatgactggggttcgaattccgatacctccact--tgtgtgt |
30614949 |
T |
 |
| Q |
162 |
gagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||| ||||| |||| |
|
|
| T |
30614948 |
gagtttataatgactttgtcatt |
30614926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #58
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 70 - 173
Target Start/End: Original strand, 34830783 - 34830883
Alignment:
| Q |
70 |
aagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttat |
169 |
Q |
| |
|
|||| |||||||| ||| |||||| ||||||||||||| ||| ||||||||||||| ||||||| || |||||||| |||||||||| ||||||||| |
|
|
| T |
34830783 |
aagtcctagctcaactgataaaatgccgaaattgttaggtcgg---atgccatgaccggagttcgaagcccggtacctctacttgtgtgtatgagtttat |
34830879 |
T |
 |
| Q |
170 |
aatg |
173 |
Q |
| |
|
|||| |
|
|
| T |
34830880 |
aatg |
34830883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #59
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 75 - 173
Target Start/End: Original strand, 2236244 - 2236339
Alignment:
| Q |
75 |
ctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatg |
173 |
Q |
| |
|
|||||||| ||| ||||||| ||||||| ||||||||| ||| ||| || ||||||||||| | ||| ||||||||||||||||||||||||||||| |
|
|
| T |
2236244 |
ctagctcaactgacaaaatgccgaaattattaggccgg---atgtcataactggggttcgaactccggttcctccacttgtgtgtgtgagtttataatg |
2236339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #60
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 67 - 184
Target Start/End: Complemental strand, 2395683 - 2395569
Alignment:
| Q |
67 |
cagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtt |
166 |
Q |
| |
|
||||||| |||| ||| || ||||||| ||||||||||||| ||| ||||||||||||||||||||| |||| || || || || ||| |||||||| |
|
|
| T |
2395683 |
cagaagtcctaggtcaactagcaaaataacgaaattgttaggtcgg---atgccatgaccggggttcgaatcctgatatcttcatttatgtatgtgagtt |
2395587 |
T |
 |
| Q |
167 |
tataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||| |||| |
|
|
| T |
2395586 |
tataatggctttgtcatt |
2395569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #61
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 68 - 177
Target Start/End: Original strand, 34762671 - 34762777
Alignment:
| Q |
68 |
agaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagttt |
167 |
Q |
| |
|
||||||||||||||| ||| ||||| ||||||| ||||||||| | ||||||| |||||||||||||| ||| ||| |||||| |||||||||||| |
|
|
| T |
34762671 |
agaagttctagctcaactgataaaatcccgaaattattaggccgg---acgccatgatcggggttcgaaccccggtgccttcacttgcgtgtgtgagttt |
34762767 |
T |
 |
| Q |
168 |
ataatggctt |
177 |
Q |
| |
|
||||||||| |
|
|
| T |
34762768 |
ttaatggctt |
34762777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #62
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 67 - 179
Target Start/End: Complemental strand, 8487679 - 8487570
Alignment:
| Q |
67 |
cagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtt |
166 |
Q |
| |
|
||||||| ||||||| |||| |||||| |||||||||||||||| |||| || | || | ||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
8487679 |
cagaagtcttagctcaactggtaaaatgccgaaattgttaggccga---atgctattatcgagattcgaaccccggtacctccacttatgtgtgtgagtt |
8487583 |
T |
 |
| Q |
167 |
tataatggctttg |
179 |
Q |
| |
|
||||||| ||||| |
|
|
| T |
8487582 |
tataatgactttg |
8487570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #63
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 88 - 184
Target Start/End: Complemental strand, 10318992 - 10318899
Alignment:
| Q |
88 |
caaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||| ||| ||||| ||||||||||||| |||||||||| |||||||| ||||| |||| |
|
|
| T |
10318992 |
caaaatgtcgaaattgttag---gttggatgccatgaccggagtttaaaccccggtacctccacttatgtgtgtgagattataatgactttgtcatt |
10318899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #64
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 88 - 178
Target Start/End: Original strand, 2746472 - 2746557
Alignment:
| Q |
88 |
caaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggcttt |
178 |
Q |
| |
|
||||||||||||||||||||||||| ||| |||||| ||||||||||||| ||||| |||| | ||||||||||||||||||| |||| |
|
|
| T |
2746472 |
caaaatgtcgaaattgttaggccgg---atgtcatgacaggggttcgaaccccggtacatcca--tttgtgtgtgagtttataatgacttt |
2746557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #65
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 65 - 184
Target Start/End: Original strand, 4128945 - 4129061
Alignment:
| Q |
65 |
tccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgag |
164 |
Q |
| |
|
||||||||| |||||||| |||| ||||| |||||||||||||| |||| ||| |||| |||||||||| || | ||||||||||| | |||||| |
|
|
| T |
4128945 |
tccagaagtcctagctcaactggtaaaataccgaaattgttaggc---cggacgccttgacgggggttcgaatccccgcccctccacttgtttatgtgag |
4129041 |
T |
 |
| Q |
165 |
tttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||| |||| |
|
|
| T |
4129042 |
tttataatggctttgccatt |
4129061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #66
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 63 - 184
Target Start/End: Complemental strand, 11242727 - 11242611
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| |||||||| || |||||| ||||||||||||| ||| |||||||||| ||||||||||||| || |||||||||||| |||| |
|
|
| T |
11242727 |
tatccagaagtcctagctcaactaataaaatgccgaaattgttaggacgg---atgccatgactggggttcgaacccctgttcctccacttgtg--tgtg |
11242633 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||| || |||| |||| |
|
|
| T |
11242632 |
agtttataacggatttgtcatt |
11242611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #67
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 62 - 184
Target Start/End: Complemental strand, 23383187 - 23383068
Alignment:
| Q |
62 |
atatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgt |
161 |
Q |
| |
|
|||| ||||||| |||| ||| || |||||||| |||||||||||| | | ||| ||| | |||||||||||||| ||||||||||||||| | | | |
|
|
| T |
23383187 |
atattcagaagtcctagttcaactagcaaaatgctgaaattgttaggtcag---atgtcataatcggggttcgaaccccggtacctccacttgtatatat |
23383091 |
T |
 |
| Q |
162 |
gagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||||| |||| |
|
|
| T |
23383090 |
gagtttataatggctttgccatt |
23383068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #68
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 62 - 171
Target Start/End: Original strand, 3456474 - 3456580
Alignment:
| Q |
62 |
atatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgt |
161 |
Q |
| |
|
|||| |||||||||||| ||| ||| ||||||||| |||||||||||| || ||||| ||| | | ||||||| | ||||||| ||||||||||||| |
|
|
| T |
3456474 |
atattcagaagttctagttcaactgacaaaatgtcaaaattgttaggc---cgtatgccttgatcagaattcgaactccggtaccttcacttgtgtgtgt |
3456570 |
T |
 |
| Q |
162 |
gagtttataa |
171 |
Q |
| |
|
|||||||||| |
|
|
| T |
3456571 |
gagtttataa |
3456580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #69
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 67 - 139
Target Start/End: Original strand, 16244413 - 16244482
Alignment:
| Q |
67 |
cagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccc |
139 |
Q |
| |
|
||||||| |||| ||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
16244413 |
cagaagtcctagatcaactggcaaaatgccgaaattgttaggc---tggatgccatgaccggggttcgaaccc |
16244482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #70
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 97 - 184
Target Start/End: Original strand, 25121860 - 25121946
Alignment:
| Q |
97 |
gaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgt--gtgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||| |||| ||||| |||||||||||| ||||||||||||||||||| | |||||||||||||||||| |||| |
|
|
| T |
25121860 |
gaaattgttaggccga---atgcaatgactagggttcgaaccccggtacctccacttgtgtgtgagagagtttataatggctttgtcatt |
25121946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #71
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 136 - 184
Target Start/End: Complemental strand, 29451738 - 29451690
Alignment:
| Q |
136 |
accctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
29451738 |
accctggtatctccacttgtgtgtgtgagtttataatgactttgccatt |
29451690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #72
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 90 - 184
Target Start/End: Complemental strand, 31242093 - 31242003
Alignment:
| Q |
90 |
aaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||||||| |||| | ||||||||||||||||| || | |||||||| ||||||||||||||||| ||| ||||| |||| |
|
|
| T |
31242093 |
aaatgtcgaaattgttaggc---cggacgtcatgaccggggttcgaatcccgacacctccac-tgtgtgtgtgagtttatgatgactttgccatt |
31242003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #73
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 122 - 184
Target Start/End: Complemental strand, 9063050 - 9062988
Alignment:
| Q |
122 |
tgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||| ||||||||||||| | ||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
9063050 |
tgacgggggttcgaacccccgcccctccacttgtgtgtatgagtttataatggctttgccatt |
9062988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #74
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 142 - 184
Target Start/End: Original strand, 26269296 - 26269338
Alignment:
| Q |
142 |
gtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
26269296 |
gtacctccacttgtatgtgtgagtttataatggctttgtcatt |
26269338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #75
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 65 - 184
Target Start/End: Original strand, 2711304 - 2711420
Alignment:
| Q |
65 |
tccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgag |
164 |
Q |
| |
|
||||||||| ||| |||| |||| ||||| ||||||||||||| ||| | ||| |||| || |||||||||| || ||||||||||||||||||| |
|
|
| T |
2711304 |
tccagaagtcctaactcaactggtaaaataccgaaattgttaggtcgg---acgccttgacgggagttcgaacccccgtccctccacttgtgtgtgtgaa |
2711400 |
T |
 |
| Q |
165 |
tttataatggctttggcatt |
184 |
Q |
| |
|
||| | ||||||||| |||| |
|
|
| T |
2711401 |
ttttttatggctttgtcatt |
2711420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #76
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 114 - 184
Target Start/End: Complemental strand, 14465904 - 14465837
Alignment:
| Q |
114 |
ggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||| ||||| ||||||||||||||| |||||| ||| ||||||||||||||||||| ||||| |||| |
|
|
| T |
14465904 |
ggatgtcatgatcggggttcgaaccctagtaccttcac---tgtgtgtgagtttataatgactttgtcatt |
14465837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #77
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 113 - 172
Target Start/End: Complemental strand, 31222716 - 31222657
Alignment:
| Q |
113 |
cggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataat |
172 |
Q |
| |
|
|||||| ||||||| | |||||||||| ||||||||||||| |||||||| |||||||| |
|
|
| T |
31222716 |
cggatgtcatgaccagagttcgaaccccggtacctccacttacgtgtgtgattttataat |
31222657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #78
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 64 - 184
Target Start/End: Complemental strand, 6453760 - 6453641
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg- |
162 |
Q |
| |
|
|||||||||| ||| |||| || ||||||| ||||||||| ||||| | ||| |||||| |||| ||||||| ||| ||| |||||||||||||| |
|
|
| T |
6453760 |
atccagaagtcctaactcaactaacaaaatgccgaaattgtcaggcctg---atgtcatgactagggtccgaaccccggttcctacacttgtgtgtgtgt |
6453664 |
T |
 |
| Q |
163 |
-agtttataatggctttggcatt |
184 |
Q |
| |
|
||||| ||||||||||| |||| |
|
|
| T |
6453663 |
gagtttgtaatggctttgccatt |
6453641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #79
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 127 - 184
Target Start/End: Complemental strand, 7974776 - 7974719
Alignment:
| Q |
127 |
ggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||| |||||| | ||||| || ||||||||||||||||||||||| |||| |||| |
|
|
| T |
7974776 |
ggggtttgaaccccgataccttcagttgtgtgtgtgagtttataatggttttgtcatt |
7974719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #80
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 70 - 184
Target Start/End: Original strand, 17546041 - 17546152
Alignment:
| Q |
70 |
aagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttat |
169 |
Q |
| |
|
|||| |||||||| || |||||||||||||||||||| | |||||| ||||| ||| ||| |||||| | || ||| |||| | |||||||||||| |
|
|
| T |
17546041 |
aagtcctagctcaattgacaaaatgtcgaaattgttag---gtcggatgtcatgatcggagtttgaaccccgatatctctacttatacgtgtgagtttat |
17546137 |
T |
 |
| Q |
170 |
aatggctttggcatt |
184 |
Q |
| |
|
||||| |||| |||| |
|
|
| T |
17546138 |
aatggttttgtcatt |
17546152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #81
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 89 - 184
Target Start/End: Original strand, 22721275 - 22721369
Alignment:
| Q |
89 |
aaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtg--tgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||| |||||||||||||||| || | |||| ||||||| ||||| | ||||||||||||| ||||||||||||||||| ||||| |||| |
|
|
| T |
22721275 |
aaaatgttgaaattgttaggccgg---atactatgatcggggttttaaccccgacacctccacttgtgtgtgtgtgagtttataatgactttgtcatt |
22721369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 88; Significance: 3e-42; HSPs: 142)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 63 - 184
Target Start/End: Original strand, 9569473 - 9569591
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| |||||||| ||||||||||| ||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9569473 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccgg---atgtcatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
9569569 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
9569570 |
agtttataatggctttgccatt |
9569591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 84; E-Value: 7e-40
Query Start/End: Original strand, 63 - 184
Target Start/End: Original strand, 7512765 - 7512883
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| |||||||| ||||||||||| | ||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
7512765 |
tatccagaagtcctagctcaactggcaaaatgccaaaattgttaggccgg---atgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtg |
7512861 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
7512862 |
agtttataatggctttgccatt |
7512883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 64 - 184
Target Start/End: Complemental strand, 5397069 - 5396952
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| ||||||||||| ||||||||||||||||| ||| |||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5397069 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccgg---atgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtga |
5396973 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
5396972 |
gtttataatggctttgccatt |
5396952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 64 - 184
Target Start/End: Complemental strand, 30044713 - 30044596
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| ||||||||||| ||||||||||||||||| ||||||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30044713 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccgg---atgccatgatcggggttcgaaccccggtacctccacttgtgtgtgtga |
30044617 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
30044616 |
gtttataatggctttgccatt |
30044596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 64 - 184
Target Start/End: Complemental strand, 49882838 - 49882721
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| ||||||||||| ||||||||||||||||| |||||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
49882838 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccgg---atgccatgaccgaggttcgaaccccggtacctccacttgtgtgtgtga |
49882742 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
49882741 |
gtttataatggctttgccatt |
49882721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 63 - 184
Target Start/End: Complemental strand, 46488247 - 46488129
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| |||||||| ||||||||||| ||||||||||||||||| ||| |||||||||||||| ||||| |||||||||||||||||||||| |
|
|
| T |
46488247 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccgg---atgtcatgaccggggttcaaaccccggtacctccacttgtgtgtgtg |
46488151 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
46488150 |
agtttataatggctttgccatt |
46488129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 63 - 184
Target Start/End: Complemental strand, 47462166 - 47462048
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
|||| |||||| |||||||| ||||||||||| ||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
47462166 |
tatctagaagtcctagctcaactggcaaaatgccgaaattgttaggccgg---atgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtg |
47462070 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||| ||||| |||| |
|
|
| T |
47462069 |
agtttataatgactttgtcatt |
47462048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 63 - 184
Target Start/End: Original strand, 49319729 - 49319847
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| |||||||| || ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
49319729 |
tatccagaagtcctagctcaactaacaaaatgtcgaaattgttaggccgg---atgccatgaccggggttcgaaccctggtacctccgcttgtgtgtgtg |
49319825 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||| ||| |||| |
|
|
| T |
49319826 |
agtttataatggcgttgccatt |
49319847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 79; E-Value: 7e-37
Query Start/End: Original strand, 64 - 184
Target Start/End: Complemental strand, 23974771 - 23974654
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| ||||||||||| ||||||||||||||||| || ||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
23974771 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccgg---atatcatgaccggtgttcgaaccctggtacctccacttgtgtgtgtga |
23974675 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
23974674 |
gtttataatggctttgccatt |
23974654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 79; E-Value: 7e-37
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 24712087 - 24712204
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| ||||||||||| ||||||||||||| ||| ||| |||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
24712087 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggtcgg---atgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtga |
24712183 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
24712184 |
gtttataatggctttgccatt |
24712204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 79; E-Value: 7e-37
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 29894409 - 29894526
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||||| ||||| ||| ||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29894409 |
atccagaagtcctagctcaactggcaaaatgtcgaaattattaggtcgg---atgtcatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
29894505 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||| |||||| |||| |
|
|
| T |
29894506 |
gtttataatagctttgccatt |
29894526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 79; E-Value: 7e-37
Query Start/End: Original strand, 64 - 184
Target Start/End: Complemental strand, 31263630 - 31263513
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||||| |||| |||| |||||||||||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
31263630 |
atccagaagtcctagctcaactggcaaaatgtcgaaattattagaccgg---atgccatgaccggggttcgaaccccggtacctccacttatgtgtgtga |
31263534 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
31263533 |
gtttataatggctttgccatt |
31263513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 79; E-Value: 7e-37
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 34684202 - 34684318
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| ||||||||||| ||||||||||||||||| ||| |||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
34684202 |
atccagaagt-ctagctcaactggcaaaatgccgaaattgttaggccgg---atgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtga |
34684297 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
34684298 |
gtttataatggctttgccatt |
34684318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 63 - 184
Target Start/End: Original strand, 13632087 - 13632206
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaa-tgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgt |
161 |
Q |
| |
|
||||||||||| |||||||| ||||||||| |||||||||||||||||||| |||||||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
13632087 |
tatccagaagtcctagctcaactggcaaaaatgtcgaaattgttaggccgg---atgccatgaccgaggttcgaaccccagtacctccacttgtgtgtgt |
13632183 |
T |
 |
| Q |
162 |
gagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||||| |||| |
|
|
| T |
13632184 |
gagtttataatggctttgccatt |
13632206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 12821164 - 12821279
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| ||||||||||| ||||||||||||||||| |||||||||||||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
12821164 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccgg---atgccatgaccggggttcgaaccccggtacctccact--tgtgtgtga |
12821258 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
12821259 |
gtttataatggctttgccatt |
12821279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 63 - 184
Target Start/End: Original strand, 28983730 - 28983848
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| ||||||||| ||| |||||||||||||||||||||| | ||||||||||||| |||||||| |
|
|
| T |
28983730 |
tatccagaagttctagctcaactggcaaaatgtcgacattgttaggtcgg---atgccatgaccggggttcgaactccggtacctccacttatgtgtgtg |
28983826 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||| ||||| |||| |
|
|
| T |
28983827 |
agtttataatgactttgtcatt |
28983848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 14285094 - 14285211
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| ||| ||||||| | ||||||||||||||| ||||||||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
14285094 |
atccagaagtcctagctcaactgacaaaatgccaaaattgttaggccgg---atgccatgaccggcgttcgaaccccggtacctccacttgtgtgtgtga |
14285190 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
14285191 |
gtttataatggctttgccatt |
14285211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 24550812 - 24550929
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| ||||||| ||||||||||| ||||||||||||||||| ||| ||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
24550812 |
atccagaagtcttagctcaactggcaaaatgccgaaattgttaggccgg---atgtcatgatcggggttcgaaccccggtacctccacttgtgtgtgtga |
24550908 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
24550909 |
gtttataatggctttgccatt |
24550929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 42856562 - 42856679
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| ||||||||||| ||||||||||||||||| ||||||||| ||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
42856562 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccgg---atgccatgatcggggttcgaattccggtacctccacttgtgtgtgtga |
42856658 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
42856659 |
gtttataatggctttgccatt |
42856679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 69 - 184
Target Start/End: Original strand, 37166142 - 37166254
Alignment:
| Q |
69 |
gaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagttta |
168 |
Q |
| |
|
||||| |||||||| ||||||||||| ||||||||||||||||| ||| ||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
37166142 |
gaagtcctagctcaactggcaaaatgccgaaattgttaggccgg---atgtcatgatcggggttcgaaccccggtacctccacttgtgtgtgtgagttta |
37166238 |
T |
 |
| Q |
169 |
taatggctttggcatt |
184 |
Q |
| |
|
||||||||||| |||| |
|
|
| T |
37166239 |
taatggctttgccatt |
37166254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 64 - 178
Target Start/End: Complemental strand, 42154267 - 42154155
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| ||||||||||| ||||||||||||||||| ||| |||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
42154267 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccgg---atgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtga |
42154171 |
T |
 |
| Q |
164 |
g-tttataatggcttt |
178 |
Q |
| |
|
| |||||||||||||| |
|
|
| T |
42154170 |
gttttataatggcttt |
42154155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 65 - 184
Target Start/End: Complemental strand, 42412116 - 42412000
Alignment:
| Q |
65 |
tccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgag |
164 |
Q |
| |
|
||||||||| ||||||| ||||||||||| ||||||||||||||| | |||||||||||||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
42412116 |
tccagaagtcatagctcaactggcaaaatgccgaaattgttaggccag---atgccatgaccggggttcgaaccccggtacctccacttatgtgtgtgag |
42412020 |
T |
 |
| Q |
165 |
tttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||| |||| |
|
|
| T |
42412019 |
tttataatggctttgccatt |
42412000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 76 - 178
Target Start/End: Complemental strand, 1053000 - 1052901
Alignment:
| Q |
76 |
tagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggc |
175 |
Q |
| |
|
||||||| ||| ||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
1053000 |
tagctcaactgacaaaatgtcgaaattgttaggccgg---atgtcatgaccggggttcgaaccctggtacctccacttgtatgtgtgagtttataatggc |
1052904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 63 - 184
Target Start/End: Original strand, 1982559 - 1982677
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| |||||||| ||||||||||| |||||||||||||||| ||| |||||||||||||| |||||||||| |||||||||||||||| |
|
|
| T |
1982559 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccgt---atgtcatgaccggggttcaaaccctggtaaatccacttgtgtgtgtg |
1982655 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
1982656 |
agtttataatggctttgccatt |
1982677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 63 - 184
Target Start/End: Original strand, 29428053 - 29428171
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| |||||||| |||||||||| ||||||||||||||||| ||| ||||| |||||||||||||| |||||||||||||||||| ||| |
|
|
| T |
29428053 |
tatccagaagtcctagctcaactggcaaaataccgaaattgttaggccgg---atgtcatgatcggggttcgaaccccggtacctccacttgtgtgagtg |
29428149 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
29428150 |
agtttataatggctttgccatt |
29428171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 62 - 184
Target Start/End: Original strand, 35828271 - 35828392
Alignment:
| Q |
62 |
atatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccact--tgtgtgt |
159 |
Q |
| |
|
|||| ||||||| |||||||| ||||||||||| ||||||||||||||||| |||||||||||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
35828271 |
atattcagaagtcctagctcaactggcaaaatgccgaaattgttaggccgg---atgccatgaccggggttcgaaccccggtacctccacttgtgtgtgt |
35828367 |
T |
 |
| Q |
160 |
gtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||| ||||||||||||||| |||| |
|
|
| T |
35828368 |
gtgaatttataatggctttgccatt |
35828392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 63 - 184
Target Start/End: Complemental strand, 50779921 - 50779803
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| ||| ||| ||||||||||| ||||||||||||||||| |||||||||||||| ||||||||| ||| |||||||||||||||||| |
|
|
| T |
50779921 |
tatccagaagtcttagttcaactggcaaaatgccgaaattgttaggccgg---atgccatgaccgggattcgaaccccggttcctccacttgtgtgtgtg |
50779825 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
50779824 |
agtttataatggctttgccatt |
50779803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 13389019 - 13389136
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| ||||||||||| |||||||||||| ||| ||| |||||||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
13389019 |
atccagaagtcctagctcaactggcaaaatgctgaaattgttaggtcgg---atgtcatgaccggggttcgaaccccggtacctccacttatgtgtgtga |
13389115 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
13389116 |
gtttataatggctttgccatt |
13389136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 68 - 184
Target Start/End: Original strand, 18813373 - 18813486
Alignment:
| Q |
68 |
agaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagttt |
167 |
Q |
| |
|
|||||| ||| |||| ||||||||||| ||||||||||||||||| ||| |||||||||| ||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
18813373 |
agaagtcctaactcaactggcaaaatgccgaaattgttaggccgg---atgtcatgaccgggcttcgaaccccggtacctccacttgtgtgtgtgagttt |
18813469 |
T |
 |
| Q |
168 |
ataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||| |||| |
|
|
| T |
18813470 |
ataatggctttgccatt |
18813486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 64 - 184
Target Start/End: Complemental strand, 36526270 - 36526153
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| || |||||| | ||||||||||||||||| ||||||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
36526270 |
atccagaagtcctagctcaactagcaaaaagccgaaattgttaggccgg---atgccatgattggggttcgaaccccggtacctccacttgtgtgtgtga |
36526174 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
36526173 |
gtttataatggctttgccatt |
36526153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 63 - 179
Target Start/End: Original strand, 49535883 - 49535996
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| |||||||| ||||||||||| ||||||||||||||||| ||||||||| |||||||||||||| ||||||| |||||||||||| |
|
|
| T |
49535883 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccgg---atgccatgatcggggttcgaaccccagtacctctacttgtgtgtgtc |
49535979 |
T |
 |
| Q |
163 |
agtttataatggctttg |
179 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
49535980 |
agtttataatggctttg |
49535996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 73 - 184
Target Start/End: Complemental strand, 25586447 - 25586339
Alignment:
| Q |
73 |
ttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataat |
172 |
Q |
| |
|
|||||||||| || |||||||| ||||||||||||||||| ||||||||| |||||||||||||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
25586447 |
ttctagctcaactagcaaaatgccgaaattgttaggccgg---atgccatgatcggggttcgaaccccggtacctccacttatgtgtgtgagtttataat |
25586351 |
T |
 |
| Q |
173 |
ggctttggcatt |
184 |
Q |
| |
|
||||||| |||| |
|
|
| T |
25586350 |
ggctttgtcatt |
25586339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 63 - 184
Target Start/End: Complemental strand, 3848948 - 3848829
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| |||||||| ||||||||||| |||||||| |||||||| |||||||||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
3848948 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgctaggccgg---atgccatgaccggggttcgaaccccggtgcctccacttgtgtgtgta |
3848852 |
T |
 |
| Q |
163 |
ag-tttataatggctttggcatt |
184 |
Q |
| |
|
|| ||||||||||||||| |||| |
|
|
| T |
3848851 |
agttttataatggctttgccatt |
3848829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 67 - 184
Target Start/End: Complemental strand, 33416706 - 33416592
Alignment:
| Q |
67 |
cagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtt |
166 |
Q |
| |
|
||||||| |||||||| |||||||||| |||||||||||| |||| ||| ||||| | ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33416706 |
cagaagtcctagctcaactggcaaaataccgaaattgttagaccgg---atgtcatgatcagggttcgaaccctggtacctccacttgtgtgtgtgagtt |
33416610 |
T |
 |
| Q |
167 |
tataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||| |||| |
|
|
| T |
33416609 |
tataatggctttgccatt |
33416592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 67 - 184
Target Start/End: Original strand, 37050703 - 37050817
Alignment:
| Q |
67 |
cagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtt |
166 |
Q |
| |
|
||||||| ||||||| ||||||||||| ||||||||||||||||| |||||||||||||||||||||||| | || |||||||| |||||||||||| |
|
|
| T |
37050703 |
cagaagtcttagctcaactggcaaaatgccgaaattgttaggccgg---atgccatgaccggggttcgaaccccgatagctccacttatgtgtgtgagtt |
37050799 |
T |
 |
| Q |
167 |
tataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||| |||| |
|
|
| T |
37050800 |
tataatggctttgccatt |
37050817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 64 - 184
Target Start/End: Complemental strand, 28010180 - 28010063
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| ||||||||||| | |||||||||||| || || |||||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
28010180 |
atccagaagtcctagctcaactggcaaaatgccaaaattgttaggcagg---atatcatgaccggggttcgaaccccggtaactccacttgtgtgtgtga |
28010084 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
28010083 |
gtttataatggctttgccatt |
28010063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 29648763 - 29648880
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| || |||||||| |||| |||||||||||| ||| ||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
29648763 |
atccagaagtcctagctcaactagcaaaatgccgaatttgttaggccgg---atgtcatgaccagggttcgaaccctggtacctccacttgtgtgtgtga |
29648859 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||| ||| ||||| |||| |
|
|
| T |
29648860 |
gtttatgatgactttgccatt |
29648880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 31375112 - 31375229
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| ||| |||| ||| ||||||||||||||| ||||||| | |||||||||||||||||||||||| ||||||||||||||||||||| | |
|
|
| T |
31375112 |
atccagaagtcctaactcaactgccaaaatgtcgaaattattaggccag---atgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtaa |
31375208 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||| ||||| |||| |
|
|
| T |
31375209 |
gtttataatgactttgtcatt |
31375229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 6487848 - 6487962
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| | ||||||| ||||||||||||||||| ||| | |||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6487848 |
atccagaagtcctagctcaac---caaaatgccgaaattgttaggccgg---atgtcgtgaccggggttcgaaccccggtacctccacttgtgtgtgtga |
6487941 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
6487942 |
gtttataatggctttgccatt |
6487962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 70 - 176
Target Start/End: Original strand, 24407502 - 24407605
Alignment:
| Q |
70 |
aagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttat |
169 |
Q |
| |
|
|||| |||||||| ||||||||||||||||||||||||| ||| |||||||||||||| ||||||||| ||||||| ||||||||||||||| ||||| |
|
|
| T |
24407502 |
aagtcctagctcaactggcaaaatgtcgaaattgttaggtcgg---atgccatgaccgggattcgaaccccggtaccttcacttgtgtgtgtgaatttat |
24407598 |
T |
 |
| Q |
170 |
aatggct |
176 |
Q |
| |
|
||||||| |
|
|
| T |
24407599 |
aatggct |
24407605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 70 - 184
Target Start/End: Original strand, 28033197 - 28033308
Alignment:
| Q |
70 |
aagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttat |
169 |
Q |
| |
|
|||| |||||||| |||| |||||| ||||||||||||||||| |||||||||||||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
28033197 |
aagtcctagctcaactggtaaaatgccgaaattgttaggccgg---atgccatgaccggggttcgaaccccagtatctccacttgtgtgtgtgagtttat |
28033293 |
T |
 |
| Q |
170 |
aatggctttggcatt |
184 |
Q |
| |
|
|||| ||||| |||| |
|
|
| T |
28033294 |
aatgactttgccatt |
28033308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 75 - 184
Target Start/End: Complemental strand, 579360 - 579254
Alignment:
| Q |
75 |
ctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatgg |
174 |
Q |
| |
|
|||||||| ||| |||||||||||||||||||||||| ||| ||||| |||||||||||||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
579360 |
ctagctcaactgataaaatgtcgaaattgttaggccgg---atgtcatgatcggggttcgaaccccggtacctccacttatgtgtgtgagtttataatgg |
579264 |
T |
 |
| Q |
175 |
ctttggcatt |
184 |
Q |
| |
|
||||| |||| |
|
|
| T |
579263 |
ctttgccatt |
579254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 68 - 176
Target Start/End: Complemental strand, 1033574 - 1033471
Alignment:
| Q |
68 |
agaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagttt |
167 |
Q |
| |
|
|||||| |||||||| ||||||||||| ||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
1033574 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccgg---atgccatgaccggggttcgaaccctaatacctccacttgtg--tgtgagttt |
1033480 |
T |
 |
| Q |
168 |
ataatggct |
176 |
Q |
| |
|
||||||||| |
|
|
| T |
1033479 |
ataatggct |
1033471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 75 - 184
Target Start/End: Complemental strand, 39997891 - 39997785
Alignment:
| Q |
75 |
ctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatgg |
174 |
Q |
| |
|
|||||||| ||| |||||||||||||||||||||||| || |||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
39997891 |
ctagctcaactgataaaatgtcgaaattgttaggccgg---ataccatgaccggggttcgaacctcggtacctccacttgtgtgtgtgagtttataatga |
39997795 |
T |
 |
| Q |
175 |
ctttggcatt |
184 |
Q |
| |
|
||||| |||| |
|
|
| T |
39997794 |
ctttgccatt |
39997785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 64 - 172
Target Start/End: Complemental strand, 3084371 - 3084266
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| ||||||||||| ||||||||||||| ||| ||||||||| ||||||||||| || | ||||||||||||||||||||| |
|
|
| T |
3084371 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggtcgg---atgccatgatcggggttcgaatcccgatacctccacttgtgtgtgtga |
3084275 |
T |
 |
| Q |
164 |
gtttataat |
172 |
Q |
| |
|
||||||||| |
|
|
| T |
3084274 |
gtttataat |
3084266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 96 - 184
Target Start/End: Complemental strand, 7944321 - 7944236
Alignment:
| Q |
96 |
cgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
7944321 |
cgaaattgttaggccgg---atgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataatggctttgccatt |
7944236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 64 - 184
Target Start/End: Complemental strand, 12316059 - 12315942
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
||||||||| |||||||| ||| ||||||||||||| |||||||| | ||||||||||| |||||||||||| | ||||||||||||||||||||| |
|
|
| T |
12316059 |
atccagaagccctagctcaactgaaaaaatgtcgaaatagttaggccag---atgccatgaccagggttcgaaccccgatacctccacttgtgtgtgtga |
12315963 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
12315962 |
gtttataatggctttgccatt |
12315942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 68 - 184
Target Start/End: Original strand, 18371349 - 18371462
Alignment:
| Q |
68 |
agaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagttt |
167 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||||||||||| || |||||| |||||| |||||| ||||||||||||| ||||||||||||| |
|
|
| T |
18371349 |
agaagttctagctcaactggcaaaatgccgaaattgttaggccga---atatcatgactggggtttgaaccccggtacctccacttatgtgtgtgagttt |
18371445 |
T |
 |
| Q |
168 |
ataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||| |||| |
|
|
| T |
18371446 |
ataatggctttgtcatt |
18371462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 35318539 - 35318656
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| ||| |||| ||||||||||| ||||||||||||||||| || ||||||||||||||||| |||||||||| |||||||| |||||| |
|
|
| T |
35318539 |
atccagaagtcctaactcaactggcaaaatgccgaaattgttaggccgg---atatcatgaccggggttcgaatcctggtaccttcacttgtgcgtgtga |
35318635 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||| |||| |||| |
|
|
| T |
35318636 |
gtttataatggttttgccatt |
35318656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 85 - 184
Target Start/End: Complemental strand, 32104118 - 32104022
Alignment:
| Q |
85 |
tggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||| ||||||||||||||||| ||||||||||||||||||||| || |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
32104118 |
tggcaaaatgccgaaattgttaggccgg---atgccatgaccggggttcgaatcccagtacttccacttgtgtgtgtgagtttataatggctttgccatt |
32104022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 63 - 184
Target Start/End: Original strand, 1083506 - 1083624
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| |||| ||| ||||||||||| ||||||||||||| | | ||| ||||| |||||||||||||| | ||||||||||||||||||| |
|
|
| T |
1083506 |
tatccagaagtcctagttcaactggcaaaatgccgaaattgttaggtcag---atgtcatgatcggggttcgaaccccgatacctccacttgtgtgtgta |
1083602 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
1083603 |
agtttataatggctttgccatt |
1083624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 113 - 184
Target Start/End: Complemental strand, 16477020 - 16476949
Alignment:
| Q |
113 |
cggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
16477020 |
cggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataatggctttgccatt |
16476949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 63 - 184
Target Start/End: Complemental strand, 31436048 - 31435930
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
|||||| |||| |||| ||| |||| |||||| ||||||||||||||||| ||| ||||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
31436048 |
tatccacaagtcctagttcaactggtaaaatgccgaaattgttaggccgg---atgtcatgattggggttcgaaccccggtacctccacttgtgtgtgtg |
31435952 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||| |||| |||| |
|
|
| T |
31435951 |
agtttataatggttttgtcatt |
31435930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 75 - 172
Target Start/End: Complemental strand, 39284692 - 39284599
Alignment:
| Q |
75 |
ctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataat |
172 |
Q |
| |
|
|||||||| |||||||| || ||||||||||||||||| ||| |||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
39284692 |
ctagctcaactggcaaa-tgccgaaattgttaggccgg---atgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataat |
39284599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 63 - 184
Target Start/End: Complemental strand, 51675797 - 51675679
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
|||||| |||| |||||||| || |||||| || ||||||||||||||| || |||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
51675797 |
tatccataagtcctagctcaactaacaaaatatctaaattgttaggccgg---atatcatgaccggggttcgaactccggtacctccacttgtgtgtgtg |
51675701 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
51675700 |
agtttataatggctttgtcatt |
51675679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 120 - 184
Target Start/End: Complemental strand, 5333282 - 5333218
Alignment:
| Q |
120 |
catgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
5333282 |
catgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataatggctttgccatt |
5333218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 70 - 184
Target Start/End: Complemental strand, 17846873 - 17846762
Alignment:
| Q |
70 |
aagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttat |
169 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||| || || | |||| || |||||||||| ||||||||||||||||||||||||||| | |
|
|
| T |
17846873 |
aagttctagctcaactggcaaaatgtcgaaattgttaggctgg---atcctatgatcgaggttcgaacctcggtacctccacttgtgtgtgtgagtttct |
17846777 |
T |
 |
| Q |
170 |
aatggctttggcatt |
184 |
Q |
| |
|
|||| ||||| |||| |
|
|
| T |
17846776 |
aatgactttgccatt |
17846762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 70 - 172
Target Start/End: Original strand, 35615890 - 35615989
Alignment:
| Q |
70 |
aagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttat |
169 |
Q |
| |
|
||||||| |||| ||| ||||||||||||||||||||||| | ||| ||||||||||||||||| |||||||||||||||| ||||||||||||||| |
|
|
| T |
35615890 |
aagttctgactcaactgacaaaatgtcgaaattgttaggccag---atgtcatgaccggggttcgaatcctggtacctccacttatgtgtgtgagtttat |
35615986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 84 - 184
Target Start/End: Complemental strand, 34660900 - 34660802
Alignment:
| Q |
84 |
ctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgag-tttataatggctttggca |
182 |
Q |
| |
|
||||||||||| | ||||||||||| ||| ||| |||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||| || |
|
|
| T |
34660900 |
ctggcaaaatgcctaaattgttaggtcgg---atgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttttataatggctttgcca |
34660804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 75 - 184
Target Start/End: Complemental strand, 52556501 - 52556396
Alignment:
| Q |
75 |
ctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatgg |
174 |
Q |
| |
|
|||||||| ||||||||||| | ||||||||||||||| ||||||||| |||||||||||||| | | ||||||||||||||||||| |||||||||| |
|
|
| T |
52556501 |
ctagctcaactggcaaaatgccaaaattgttaggccgg---atgccatgatcggggttcgaaccccgat-cctccacttgtgtgtgtgaatttataatgg |
52556406 |
T |
 |
| Q |
175 |
ctttggcatt |
184 |
Q |
| |
|
||||| |||| |
|
|
| T |
52556405 |
ctttgccatt |
52556396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 75 - 179
Target Start/End: Original strand, 26440977 - 26441078
Alignment:
| Q |
75 |
ctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatgg |
174 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||| || ||||||| |||||| ||||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
26440977 |
ctagctcaactggcaaaatgccgaaattgttaggccggg---tgtcatgaccagggttccaaccctgatacctccacttgtgtgtgtgaatttataatga |
26441073 |
T |
 |
| Q |
175 |
ctttg |
179 |
Q |
| |
|
||||| |
|
|
| T |
26441074 |
ctttg |
26441078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 42116480 - 42116596
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
||||||||| |||||||| |||| |||||||||||||| ||||| ||| ||||||||| |||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
42116480 |
atccagaagccctagctcaactggtaaaatgtcgaaatttttaggtcgg---atgccatgatcggggttcgaaccccggtac-tccacttgtgtgtgtga |
42116575 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
||||| |||| ||||| |||| |
|
|
| T |
42116576 |
gtttacaatgactttgtcatt |
42116596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 67 - 174
Target Start/End: Complemental strand, 9038332 - 9038228
Alignment:
| Q |
67 |
cagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtt |
166 |
Q |
| |
|
|||||||||||||||| || |||||||| |||||||||| | |||| ||| ||||||||| ||| ||| || |||||||||||||||||||||||||| |
|
|
| T |
9038332 |
cagaagttctagctcaactagcaaaatgccgaaattgtttgaccgg---atgtcatgaccggagtttgaatcccggtacctccacttgtgtgtgtgagtt |
9038236 |
T |
 |
| Q |
167 |
tataatgg |
174 |
Q |
| |
|
|||||||| |
|
|
| T |
9038235 |
tataatgg |
9038228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 64 - 184
Target Start/End: Complemental strand, 25699069 - 25698950
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtg--tgt |
161 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||| ||||||||| ||||||||| ||| |||||||| |||||||||||||||||| ||| |
|
|
| T |
25699069 |
atccagaagtcctagctcaagaggcaaaatgtcgaaattattaggccgg---atgccatgatcggagttcgaacagcggtacctccacttgtgtgtgtgt |
25698973 |
T |
 |
| Q |
162 |
gagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||||| |||| |
|
|
| T |
25698972 |
gagtttataatggctttgccatt |
25698950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 89 - 184
Target Start/End: Complemental strand, 36860953 - 36860861
Alignment:
| Q |
89 |
aaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||| ||| ||||||||||||| ||| ||| || ||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
36860953 |
aaaatgccgatattgttaggccgg---atgtcataactggggttcgaaccccggtacctccacttgtgtgtgtgagtttataatggctttgccatt |
36860861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 76 - 184
Target Start/End: Original strand, 51281477 - 51281584
Alignment:
| Q |
76 |
tagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccact--tgtgtgtgtgagtttataatg |
173 |
Q |
| |
|
||||||| ||||||||||| ||||||||||||||||| ||||||||||||| |||||||||| | |||||||||| ||||||||||| ||||||||| |
|
|
| T |
51281477 |
tagctcaactggcaaaatgccgaaattgttaggccgg---atgccatgaccggagttcgaaccccgatacctccacttgtgtgtgtgtgaatttataatg |
51281573 |
T |
 |
| Q |
174 |
gctttggcatt |
184 |
Q |
| |
|
||||| |||| |
|
|
| T |
51281574 |
actttgtcatt |
51281584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 70 - 179
Target Start/End: Original strand, 17271304 - 17271410
Alignment:
| Q |
70 |
aagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttat |
169 |
Q |
| |
|
|||| |||||||| | | ||||||| ||||||||||||||| |||||||||| |||||| |||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
17271304 |
aagtcctagctcaacggacaaaatgccgaaattgttaggccaa---atgccatgactggggtttgaaccccggtacctccacttatgtgtgtgagtttat |
17271400 |
T |
 |
| Q |
170 |
aatggctttg |
179 |
Q |
| |
|
|||||||||| |
|
|
| T |
17271401 |
aatggctttg |
17271410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 75 - 184
Target Start/End: Original strand, 29334505 - 29334611
Alignment:
| Q |
75 |
ctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatgg |
174 |
Q |
| |
|
|||| ||| |||||||||| ||||||||||||| ||| ||| ||||||||| |||| ||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
29334505 |
ctagttcaactggcaaaataccgaaattgttaggtcgg---atgtcatgaccggagttcaaaccccggtacctccatttgtgtgtgtgagtttataatgg |
29334601 |
T |
 |
| Q |
175 |
ctttggcatt |
184 |
Q |
| |
|
||||| |||| |
|
|
| T |
29334602 |
ctttgccatt |
29334611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 63 - 184
Target Start/End: Original strand, 36752357 - 36752475
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| ||| |||| ||| ||||||| ||||||||||||||| | ||| ||||| |||||||||||||| | ||||||||||| | | |||| |
|
|
| T |
36752357 |
tatccagaagtcctaactcaactgacaaaatgccgaaattgttaggccag---atgtcatgatcggggttcgaaccccgatacctccacttatatatgtg |
36752453 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
36752454 |
agtttataatggctttgtcatt |
36752475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 62 - 163
Target Start/End: Complemental strand, 39301401 - 39301303
Alignment:
| Q |
62 |
atatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgt |
161 |
Q |
| |
|
|||||||||||| |||| ||| |||||||| || |||| |||||||||||| || ||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
39301401 |
atatccagaagtcctagttcaactggcaaactgccgaatttgttaggccgg---atatcatgaccagggttcgaaccctggtacctccacttgtgtgtgt |
39301305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 67 - 184
Target Start/End: Original strand, 54864398 - 54864512
Alignment:
| Q |
67 |
cagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtt |
166 |
Q |
| |
|
||||||| |||| ||| || |||||||||| ||||||||||| ||| ||||||||| ||||||| ||||| |||||||| ||||||||||||||||| |
|
|
| T |
54864398 |
cagaagtcctagatcaactagcaaaatgtcaaaattgttaggtcgg---atgccatgatcggggtttgaacctcggtacctcaacttgtgtgtgtgagtt |
54864494 |
T |
 |
| Q |
167 |
tataatggctttggcatt |
184 |
Q |
| |
|
||||||| ||||| |||| |
|
|
| T |
54864495 |
tataatgactttgtcatt |
54864512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 3037236 - 3037353
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||| | |||||||| ||| ||||||| ||||||| |||||| || ||| |||||||||||||||||| | || |||||||||| ||||||||| |
|
|
| T |
3037236 |
atccagaaatcctagctcaactgtcaaaatgccgaaattattaggctgg---atgtcatgaccggggttcgaactccggcacctccacttatgtgtgtga |
3037332 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||| |||| |||| |
|
|
| T |
3037333 |
gtttataatggttttgtcatt |
3037353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 64 - 172
Target Start/End: Complemental strand, 17518602 - 17518497
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| ||||||| |||| |||||| | ||||||||| ||||| ||||||||| |||||||| |||||||||||||||| || ||||||||| |
|
|
| T |
17518602 |
atccagaagtcttagctcaactggtaaaatgccaaaattgttacgccgg---atgccatgatcggggttcaaaccctggtacctccatttatgtgtgtga |
17518506 |
T |
 |
| Q |
164 |
gtttataat |
172 |
Q |
| |
|
||||||||| |
|
|
| T |
17518505 |
gtttataat |
17518497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 68 - 184
Target Start/End: Complemental strand, 54908017 - 54907904
Alignment:
| Q |
68 |
agaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagttt |
167 |
Q |
| |
|
|||||| |||||||| ||||||||||| |||||||||||||| |||||||||||| || |||| |||||| ||||| | || || ||||||| ||||| |
|
|
| T |
54908017 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggc---cggatgccatgatcgaggtttgaaccccggtacattcatttatgtgtgtaagttt |
54907921 |
T |
 |
| Q |
168 |
ataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||| |||| |
|
|
| T |
54907920 |
ataatggctttgccatt |
54907904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 115 - 184
Target Start/End: Complemental strand, 9747346 - 9747277
Alignment:
| Q |
115 |
gatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||| ||||||||||||| || ||||||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
9747346 |
gatgccatgatcggggttcgaaccttgatacctccacttgtatgtgtgagtttataatggctttgccatt |
9747277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 89 - 184
Target Start/End: Original strand, 46552949 - 46553041
Alignment:
| Q |
89 |
aaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||| | ||||||||||||||| ||| |||||||||||||||||||| ||||||||||||| ||||||||| |||||||||| |||| |||| |
|
|
| T |
46552949 |
aaaatgccaaaattgttaggccgg---atgtcatgaccggggttcgaaccccggtacctccacttatgtgtgtgaatttataatggttttgccatt |
46553041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 67 - 153
Target Start/End: Complemental strand, 5880412 - 5880329
Alignment:
| Q |
67 |
cagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccactt |
153 |
Q |
| |
|
||||||| ||| |||| |||||||||||||||||||||||| |||| |||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
5880412 |
cagaagtcctaactcaactggcaaaatgtcgaaattgttagaccgg---atgccatgaccggggttcgaaccccgatacctccactt |
5880329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 4379306 - 4379421
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||| ||| ||| ||||||| |||||||||||||| |||||||||||||||| ||||||| || | ||| || ||| ||||||||| |
|
|
| T |
4379306 |
atccagaagtcctagttcaactgacaaaatgccgaaattgttaggc---cggatgccatgaccggagttcgaatcccgatacatcaact--tgtgtgtga |
4379400 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
4379401 |
gtttataatggctttgccatt |
4379421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 63 - 184
Target Start/End: Complemental strand, 11371190 - 11371072
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
|||||||| || |||| ||| |||| | |||| |||||||||||||| | || ||||||| ||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
11371190 |
tatccagacgtcctagttcaactggaataatgccgaaattgttaggctag---ataccatgacaggggttcgaaccccggtacctccacttgtatgtgtg |
11371094 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||| ||||| |||| |
|
|
| T |
11371093 |
agtttataatgactttgccatt |
11371072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 70 - 179
Target Start/End: Original strand, 11673298 - 11673403
Alignment:
| Q |
70 |
aagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttat |
169 |
Q |
| |
|
|||| |||||||| |||||||||| |||||||||||||| || ||||||||| |||||||||||||| | ||||||||||| ||||||| ||||||| |
|
|
| T |
11673298 |
aagtcctagctcaactggcaaaataccgaaattgttaggcagg---atgccatgatcggggttcgaaccccg-tacctccacttatgtgtgtaagtttat |
11673393 |
T |
 |
| Q |
170 |
aatggctttg |
179 |
Q |
| |
|
|||| ||||| |
|
|
| T |
11673394 |
aatgactttg |
11673403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 17480930 - 17481048
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaa-tgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||| ||||||||||||| ||| ||||| || | |||||||||||||| ||||||||| | |||||||||||| ||||| ||||||| ||| |||| |
|
|
| T |
17480930 |
atccacaagttctagctcaactgacaaaaatgccaaaattgttaggccga---atgccatgatcagggttcgaaccccggtacttccacttatgtatgtg |
17481026 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
17481027 |
agtttataatggctttgtcatt |
17481048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #82
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 96 - 184
Target Start/End: Original strand, 21378319 - 21378402
Alignment:
| Q |
96 |
cgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||| | |||||||||||| | ||||||||||||||||||||||| |||| |
|
|
| T |
21378319 |
cgaaattgttaggccgg---atgccatgaccggggttcgaactccggtacctccact--tatgtgtgagtttataatggctttgccatt |
21378402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #83
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 113 - 184
Target Start/End: Complemental strand, 54097023 - 54096952
Alignment:
| Q |
113 |
cggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||| |||||||| |||||||||| ||||||||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
54097023 |
cggatgtcatgaccgacgttcgaaccccggtacctccacttgtgtgtgtgagtttataatgactttgtcatt |
54096952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #84
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 113 - 179
Target Start/End: Complemental strand, 8810852 - 8810786
Alignment:
| Q |
113 |
cggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttg |
179 |
Q |
| |
|
|||||| ||||||||| |||||||||| |||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
8810852 |
cggatgtcatgaccggagttcgaaccccggtacctcaacttgtgtgtgtgagtttataatgactttg |
8810786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #85
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 114 - 168
Target Start/End: Original strand, 38814629 - 38814683
Alignment:
| Q |
114 |
ggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagttta |
168 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
38814629 |
ggatgccatgaccggggttcgaaccccgatacctccacttgtgtgtgtgagttta |
38814683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #86
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 114 - 184
Target Start/End: Complemental strand, 48628546 - 48628476
Alignment:
| Q |
114 |
ggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||| ||||||||||||| |||| || || |||||||||||||||||||||||||||| |||| |
|
|
| T |
48628546 |
ggatgccatgactggggttcgaaccccggtatcttcatttgtgtgtgtgagtttataatggctttgccatt |
48628476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #87
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 68 - 184
Target Start/End: Complemental strand, 28187289 - 28187172
Alignment:
| Q |
68 |
agaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccact----tgtgtgtgtga |
163 |
Q |
| |
|
|||||| |||||||| ||| ||||||||||||||||||||| ||||||| |||| |||||||||||| | ||||||||||| ||||||||||| |
|
|
| T |
28187289 |
agaagtcctagctcaactgataaaatgtcgaaattgttaggc---cggatgctatgatcggggttcgaactccagtacctccacttatgtgtgtgtgtga |
28187193 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||| ||||| |||| |
|
|
| T |
28187192 |
gtttataatgactttgccatt |
28187172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #88
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 127 - 184
Target Start/End: Complemental strand, 31583672 - 31583615
Alignment:
| Q |
127 |
ggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||| ||||||||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
31583672 |
ggggttcgaaccccggtacctccacttatgtgtgtgagtttataatggctttgccatt |
31583615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #89
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 63 - 184
Target Start/End: Complemental strand, 9064919 - 9064800
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacc-tccacttgtgtgtgt |
161 |
Q |
| |
|
|||||| |||| |||||||| || | |||||| |||||||||||| || ||||||| | |||||||||||||| |||||| ||||||||||||||| |
|
|
| T |
9064919 |
tatccacaagtcctagctcaactagtaaaatgctgaaattgttaggtcga---atgccataatcggggttcgaaccccggtaccctccacttgtgtgtgt |
9064823 |
T |
 |
| Q |
162 |
gagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||| ||||| |||| |
|
|
| T |
9064822 |
gagtttataatgactttgtcatt |
9064800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #90
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 98 - 172
Target Start/End: Complemental strand, 16971777 - 16971706
Alignment:
| Q |
98 |
aaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataat |
172 |
Q |
| |
|
||||||||||||||| ||| ||||||||||||||||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
16971777 |
aaattgttaggccgg---atgttatgaccggggttcgaaccccgctacctccacttgtgtgtgtgagtttataat |
16971706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #91
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 75 - 169
Target Start/End: Complemental strand, 51564509 - 51564418
Alignment:
| Q |
75 |
ctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttat |
169 |
Q |
| |
|
|||||||| ||||||||||| ||||| ||||||||||| | ||||||||| |||||||||||| || |||||||||| || |||||||||||| |
|
|
| T |
51564509 |
ctagctcaactggcaaaatgccgaaactgttaggccgg---acgccatgaccagggttcgaaccccggcacctccacttatgcgtgtgagtttat |
51564418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #92
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 113 - 184
Target Start/End: Original strand, 7413137 - 7413208
Alignment:
| Q |
113 |
cggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||| ||||||||||||| || ||||||||||||| | ||||||||||||||||| ||||| |||| |
|
|
| T |
7413137 |
cggatgccataaccggggttcgaatcccggtacctccacttatatgtgtgagtttataatgactttgtcatt |
7413208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #93
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 113 - 184
Target Start/End: Original strand, 7459217 - 7459288
Alignment:
| Q |
113 |
cggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||| ||||||||||||| || ||||||||||||| | ||||||||||||||||| ||||| |||| |
|
|
| T |
7459217 |
cggatgccataaccggggttcgaatcccggtacctccacttatatgtgtgagtttataatgactttgtcatt |
7459288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #94
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 84 - 173
Target Start/End: Original strand, 13218216 - 13218302
Alignment:
| Q |
84 |
ctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatg |
173 |
Q |
| |
|
|||| |||||||| ||||||||||| ||| ||||||||| |||||||||||||| |||| ||||||||| ||||||||||||||||| |
|
|
| T |
13218216 |
ctggaaaaatgtcaaaattgttaggtcgg---atgccatgatcggggttcgaaccccagtacttccacttgtatgtgtgagtttataatg |
13218302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #95
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 63 - 172
Target Start/End: Original strand, 41323532 - 41323638
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
|||| |||||||||| |||| ||| ||||||||||||||||||| ||||||| |||| ||||||||||||| ||||||| ||||| |||||||| |
|
|
| T |
41323532 |
tatcaagaagttctaactcaactgataaaatgtcgaaattgttag---atcggatgctatgattggggttcgaaccccggtaccttcacttctgtgtgtg |
41323628 |
T |
 |
| Q |
163 |
agtttataat |
172 |
Q |
| |
|
|||||||||| |
|
|
| T |
41323629 |
agtttataat |
41323638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #96
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 134 - 184
Target Start/End: Original strand, 25003798 - 25003848
Alignment:
| Q |
134 |
gaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
25003798 |
gaaccccggtacctccacttgtgtgtgtgagtttataatggctttgccatt |
25003848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #97
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 127 - 184
Target Start/End: Original strand, 32233671 - 32233728
Alignment:
| Q |
127 |
ggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||| |||||| ||||||||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
32233671 |
ggggtttgaaccccggtacctccacttgtgtgtgtgagtttataatgactttgtcatt |
32233728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #98
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 68 - 178
Target Start/End: Original strand, 8017853 - 8017960
Alignment:
| Q |
68 |
agaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagttt |
167 |
Q |
| |
|
|||||| |||||||| ||| ||||||| |||||||||||||||| ||| |||||||||||| |||| | | ||||||||||| ||||||||||||| |
|
|
| T |
8017853 |
agaagtactagctcaactgataaaatgttgaaattgttaggccgg---atgttatgaccggggttagaactccgatacctccacttttgtgtgtgagttt |
8017949 |
T |
 |
| Q |
168 |
ataatggcttt |
178 |
Q |
| |
|
| |||| |||| |
|
|
| T |
8017950 |
aaaatgacttt |
8017960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #99
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 113 - 172
Target Start/End: Original strand, 17358091 - 17358150
Alignment:
| Q |
113 |
cggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataat |
172 |
Q |
| |
|
|||||| ||||| |||||||||||||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
17358091 |
cggatgtcatgatcggggttcgaaccccagtatctccacttgtgtgtgtgagtttataat |
17358150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #100
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 64 - 173
Target Start/End: Complemental strand, 10758016 - 10757910
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgt--gt |
161 |
Q |
| |
|
|||||||||| ||| |||| ||| ||||||| |||||||||||| | |||||||||||| ||| ||| |||||| ||||||||||||||||||| || |
|
|
| T |
10758016 |
atccagaagtcctacctcaactgccaaaatgccgaaattgttag---gtcggatgccatga-cggagtttgaaccc-ggtacctccacttgtgtgtgagt |
10757922 |
T |
 |
| Q |
162 |
gagtttataatg |
173 |
Q |
| |
|
|||||||||||| |
|
|
| T |
10757921 |
gagtttataatg |
10757910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #101
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 64 - 173
Target Start/End: Complemental strand, 10971187 - 10971081
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgt--gt |
161 |
Q |
| |
|
|||||||||| ||| |||| ||| ||||||| |||||||||||| | |||||||||||| ||| ||| |||||| ||||||||||||||||||| || |
|
|
| T |
10971187 |
atccagaagtcctacctcaactgccaaaatgccgaaattgttag---gtcggatgccatga-cggagtttgaaccc-ggtacctccacttgtgtgtgagt |
10971093 |
T |
 |
| Q |
162 |
gagtttataatg |
173 |
Q |
| |
|
|||||||||||| |
|
|
| T |
10971092 |
gagtttataatg |
10971081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #102
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 63 - 151
Target Start/End: Original strand, 12694521 - 12694606
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccac |
151 |
Q |
| |
|
||||||||||| |||||||| ||| ||||||| |||| ||||||||||| ||||||||||||||||||||| || | ||||||||| |
|
|
| T |
12694521 |
tatccagaagtcctagctcaactgacaaaatgctgaaactgttaggccgg---atgccatgaccggggttcgaatcccgatacctccac |
12694606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #103
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 130 - 184
Target Start/End: Complemental strand, 17815209 - 17815155
Alignment:
| Q |
130 |
gttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||| ||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
17815209 |
gttcgaaccccagtacctccatttgtgtgtgtgagtttataatggctttgccatt |
17815155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #104
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 85 - 184
Target Start/End: Original strand, 36608021 - 36608116
Alignment:
| Q |
85 |
tggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||||||||| ||| ||||||| |||||||||||| | ||||||| ||||| ||| || |||||||||||||||||| |||| |
|
|
| T |
36608021 |
tggcaaaatgtcgaaattgttagct----ggacgccatgatcggggttcgaactccggtaccttcacttatgtatgggagtttataatggctttgccatt |
36608116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #105
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 115 - 178
Target Start/End: Original strand, 37913352 - 37913417
Alignment:
| Q |
115 |
gatgccatgaccggggttcgaaccctggtacctccact--tgtgtgtgtgagtttataatggcttt |
178 |
Q |
| |
|
|||| ||||| |||||||||||||| |||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
37913352 |
gatgtcatgatcggggttcgaaccccggtacctccacttatgtgtgtgagagtttataatggcttt |
37913417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #106
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 89 - 184
Target Start/End: Original strand, 3780338 - 3780430
Alignment:
| Q |
89 |
aaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||| ||||||||||||||| | | | |||||| | ||||||||| | ||||||||||||||| ||||| ||||||||||||||||| |||| |
|
|
| T |
3780338 |
aaaatgccgaaattgttaggccag---acgtcatgactgaggttcgaactccggtacctccacttgtatgtgtaagtttataatggctttgtcatt |
3780430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #107
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 67 - 174
Target Start/End: Original strand, 4901924 - 4902027
Alignment:
| Q |
67 |
cagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtt |
166 |
Q |
| |
|
||||||| ||||||| ||| |||||||| |||||||||||| ||||||| |||||||||| ||||| ||||||| ||||| || ||||||| |||| |
|
|
| T |
4901924 |
cagaagtcctagctcgactgataaaatgtcaaaattgttaggc---cggatgctatgaccggggctcgaatcctggtatctcca-ttatgtgtgtaagtt |
4902019 |
T |
 |
| Q |
167 |
tataatgg |
174 |
Q |
| |
|
|||||||| |
|
|
| T |
4902020 |
tataatgg |
4902027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #108
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 64 - 179
Target Start/End: Original strand, 25726594 - 25726706
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
||||| |||| |||||| | | || |||||| |||||||||||||| | ||||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
25726594 |
atccacaagtcctagcttaaccggtaaaatgacgaaattgttaggcaga---atgccatgatcggggttcgaacttaagtacctccacttgtgtgtgtga |
25726690 |
T |
 |
| Q |
164 |
gtttataatggctttg |
179 |
Q |
| |
|
|||||| ||| ||||| |
|
|
| T |
25726691 |
gtttatgatgactttg |
25726706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #109
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 127 - 184
Target Start/End: Complemental strand, 33583685 - 33583628
Alignment:
| Q |
127 |
ggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
33583685 |
ggggttcgaaccatgacacctccacttgtgtgtgtgagtttataacggctttgccatt |
33583628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #110
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 143 - 184
Target Start/End: Original strand, 34567102 - 34567143
Alignment:
| Q |
143 |
tacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
34567102 |
tacctccacttgtgtgtgtgagtttataatggctttgccatt |
34567143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #111
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 64 - 172
Target Start/End: Original strand, 44171648 - 44171755
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtg--t |
161 |
Q |
| |
|
|||||||||| |||||||| || |||||||| | ||||| ||| ||||| ||| ||||||||||| |||||||| | ||| |||||||||||||| | |
|
|
| T |
44171648 |
atccagaagtcctagctcaactagcaaaatgccaaaattattaagccgg---atgacatgaccgggggtcgaaccccgatacttccacttgtgtgtgtat |
44171744 |
T |
 |
| Q |
162 |
gagtttataat |
172 |
Q |
| |
|
||||||||||| |
|
|
| T |
44171745 |
gagtttataat |
44171755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #112
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 88 - 178
Target Start/End: Original strand, 45725161 - 45725247
Alignment:
| Q |
88 |
caaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggcttt |
178 |
Q |
| |
|
||||||| |||||||||||||| ||||| ||||| || |||||||||| ||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
45725161 |
caaaatgccgaaattgttaggc----ggatgtcatgatcgaggttcgaacctcggtacctttacttgtgtgtgtgagtttataatgacttt |
45725247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #113
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 63 - 178
Target Start/End: Complemental strand, 53398418 - 53398306
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
|||||| ||||| ||||||| |||||||||||| ||||||||||||| | ||| ||||||||| |||||||| | | ||| | ||||||||||||| |
|
|
| T |
53398418 |
tatccacaagttttagctcaactggcaaaatgttgaaattgttaggc---tgaatgtcatgaccggagttcgaactcggatactttcacttgtgtgtgta |
53398322 |
T |
 |
| Q |
163 |
agtttataatggcttt |
178 |
Q |
| |
|
||| ||||||| |||| |
|
|
| T |
53398321 |
agtatataatgacttt |
53398306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #114
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 63 - 184
Target Start/End: Original strand, 2573927 - 2574045
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaatt-gttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgt |
161 |
Q |
| |
|
|||| |||||| |||||||| | || |||||||||||||| |||||| ||| ||| ||||| |||| ||||||| | ||||| ||||||||||| ||| |
|
|
| T |
2573927 |
tatctagaagtcctagctcaacaggtaaaatgtcgaaatttgttaggtcgg---atgtcatgatcgggattcgaactccggtacatccacttgtgtatgt |
2574023 |
T |
 |
| Q |
162 |
gagtttataatggctttggcatt |
184 |
Q |
| |
|
||| |||||||||||||| |||| |
|
|
| T |
2574024 |
gag-ttataatggctttgccatt |
2574045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #115
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 120 - 179
Target Start/End: Original strand, 28758429 - 28758489
Alignment:
| Q |
120 |
catgaccggggttcgaaccctggtacctccactt-gtgtgtgtgagtttataatggctttg |
179 |
Q |
| |
|
||||||||| |||||||||| |||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
28758429 |
catgaccggagttcgaaccccagtacctccactttgtgtgtgtgagtttataatgactttg |
28758489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #116
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 70 - 160
Target Start/End: Original strand, 46194254 - 46194341
Alignment:
| Q |
70 |
aagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtg |
160 |
Q |
| |
|
|||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| | |||||||||| | |||| ||||||||||||||| |
|
|
| T |
46194254 |
aagtcctagctcaactggcaaaatgtcaaaattgttag---gtcggatgtcatgatcagggttcgaactccggtaactccacttgtgtgtg |
46194341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #117
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 113 - 184
Target Start/End: Complemental strand, 2942518 - 2942447
Alignment:
| Q |
113 |
cggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||| |||| ||||||||| | |||||||||||| | |||||||||||| ||| ||||| |||| |
|
|
| T |
2942518 |
cggatgccatgatcgggattcgaaccccgatacctccacttgcgcgtgtgagtttatgatgactttgccatt |
2942447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #118
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 92 - 184
Target Start/End: Complemental strand, 42550524 - 42550434
Alignment:
| Q |
92 |
atgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccac-ttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||| ||||||||||||||| |||||||||||||| |||||| || |||||||||| || | ||||| ||||||||||||||||| |||| |
|
|
| T |
42550524 |
atgtcaaaattgttaggccgg---atgccatgaccgggattcgaatcccagtacctccactttatatgtgtaagtttataatggctttgccatt |
42550434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #119
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 113 - 179
Target Start/End: Original strand, 55214521 - 55214587
Alignment:
| Q |
113 |
cggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgag-tttataatggctttg |
179 |
Q |
| |
|
||||||||||||||| |||||| || |||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
55214521 |
cggatgccatgaccgaa-ttcgaatcccggtacctccacttgtgtgtgtgagttttataatggctttg |
55214587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #120
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 126 - 172
Target Start/End: Original strand, 939645 - 939691
Alignment:
| Q |
126 |
cggggttcgaaccctggtacctccacttgtgtgtgtgagtttataat |
172 |
Q |
| |
|
||||||||||||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
939645 |
cggggttcgaaccacggtacctccacttatgtgtgtgagtttataat |
939691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #121
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 84 - 184
Target Start/End: Complemental strand, 54420270 - 54420173
Alignment:
| Q |
84 |
ctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcat |
183 |
Q |
| |
|
|||| |||||| ||||||||||| || ||||||| | ||| || ||||||||| ||||||||| |||| ||||||| |||||||||| |||||| ||| |
|
|
| T |
54420270 |
ctggtaaaatgccgaaattgttatgc---cggatgctaggactggagttcgaaccatggtacctctacttatgtgtgtaagtttataatagctttgccat |
54420174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #122
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 141 - 178
Target Start/End: Complemental strand, 3802986 - 3802949
Alignment:
| Q |
141 |
ggtacctccacttgtgtgtgtgagtttataatggcttt |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
3802986 |
ggtacctccacttgtgtgtgtgagtttataatgacttt |
3802949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #123
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 70 - 179
Target Start/End: Original strand, 24870601 - 24870709
Alignment:
| Q |
70 |
aagttctagctcagctggcaaaa-tgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccac-ttgtgtgtgtgagttt |
167 |
Q |
| |
|
|||| |||||||| ||||||||| || ||||||||||||||||| | | ||||||| |||||||||| ||||||||||| || |||||||||||| |
|
|
| T |
24870601 |
aagtcctagctcaactggcaaaaatgccgaaattgttaggccgg---acgtaatgaccgaggttcgaacctcggtacctccactttacgtgtgtgagttt |
24870697 |
T |
 |
| Q |
168 |
ataatggctttg |
179 |
Q |
| |
|
|| ||||||||| |
|
|
| T |
24870698 |
atgatggctttg |
24870709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #124
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 127 - 184
Target Start/End: Complemental strand, 35352159 - 35352102
Alignment:
| Q |
127 |
ggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||| |||||| |||||||| |||||||||| ||||||||||||| ||||| |||| |
|
|
| T |
35352159 |
ggggtttgaaccccggtacctctacttgtgtgtctgagtttataatgtctttgtcatt |
35352102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #125
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 115 - 184
Target Start/End: Original strand, 40996413 - 40996482
Alignment:
| Q |
115 |
gatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||| |||| |||||||||||||| || ||||||| || ||| |||||||||||||||| |||| |||| |
|
|
| T |
40996413 |
gatgctatgatcggggttcgaaccccggcacctccatttatgtatgtgagtttataatggttttgccatt |
40996482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #126
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 70 - 179
Target Start/End: Original strand, 46343333 - 46343441
Alignment:
| Q |
70 |
aagttctagctcagctggcaaaa-tgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctcca-cttgtgtgtgtgagttt |
167 |
Q |
| |
|
|||| |||||||| ||| ||||| || ||||||||||||||||| | | ||||||||||||||||||||| ||||||||| || |||||||||||| |
|
|
| T |
46343333 |
aagtcctagctcaactgacaaaagtgccgaaattgttaggccgg---acgtcatgaccggggttcgaaccctagtacctccattttacgtgtgtgagttt |
46343429 |
T |
 |
| Q |
168 |
ataatggctttg |
179 |
Q |
| |
|
|| ||| ||||| |
|
|
| T |
46343430 |
atgatgactttg |
46343441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #127
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 89 - 184
Target Start/End: Complemental strand, 9749186 - 9749098
Alignment:
| Q |
89 |
aaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||| ||||||||||| ||||| ||||||||| |||| ||||||||||| |||||| || ||||||||||||||||||| |||| |||| |
|
|
| T |
9749186 |
aaaatgccgaaattgttatgccgg---atgccatgatcgggattcgaaccctgatacctctac----gtgtgtgagtttataatggttttgtcatt |
9749098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #128
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 142 - 178
Target Start/End: Complemental strand, 11310230 - 11310194
Alignment:
| Q |
142 |
gtacctccacttgtgtgtgtgagtttataatggcttt |
178 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| |
|
|
| T |
11310230 |
gtacctccacttatgtgtgtgagtttataatggcttt |
11310194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #129
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 89 - 159
Target Start/End: Complemental strand, 11311630 - 11311564
Alignment:
| Q |
89 |
aaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgt |
159 |
Q |
| |
|
|||||| ||||||||||||||||| ||| |||||| ||||||||||| | ||||||||||||||||||| |
|
|
| T |
11311630 |
aaaatgccgaaattgttaggccgg---atgtcatgac-ggggttcgaactccggtacctccacttgtgtgt |
11311564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #130
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 70 - 184
Target Start/End: Original strand, 52772121 - 52772232
Alignment:
| Q |
70 |
aagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttat |
169 |
Q |
| |
|
|||||||| |||| ||| |||||| | ||||||||||| ||| ||||| ||| ||||||||||| || | ||||| ||||||||||||| ||||||| |
|
|
| T |
52772121 |
aagttctaactcaattggtaaaatgccaaaattgttaggtcgg---atgccttgatcggggttcgaatcccgataccttcacttgtgtgtgtaagtttat |
52772217 |
T |
 |
| Q |
170 |
aatggctttggcatt |
184 |
Q |
| |
|
| || ||||| |||| |
|
|
| T |
52772218 |
attgactttgtcatt |
52772232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #131
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 60 - 172
Target Start/End: Complemental strand, 5060543 - 5060436
Alignment:
| Q |
60 |
ttatatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgt |
159 |
Q |
| |
|
|||||||||||||| ||| |||| ||| ||||||||||||||||||| | ||||| ||||| ||| |||||||||| | ||||| |||| | ||| |
|
|
| T |
5060543 |
ttatatccagaagtcctaactcaactgataaaatgtcgaaattgttagtc---cggatatcatgatcggcgttcgaaccccgataccttcact--tatgt |
5060449 |
T |
 |
| Q |
160 |
gtgagtttataat |
172 |
Q |
| |
|
||||||||||||| |
|
|
| T |
5060448 |
gtgagtttataat |
5060436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #132
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 128 - 179
Target Start/End: Original strand, 16460995 - 16461046
Alignment:
| Q |
128 |
gggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttg |
179 |
Q |
| |
|
|||||||||||| | |||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
16460995 |
gggttcgaaccccgacaccttcacttgtgtgtgtgagtttataagggctttg |
16461046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #133
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 122 - 165
Target Start/End: Complemental strand, 19392210 - 19392167
Alignment:
| Q |
122 |
tgaccggggttcgaaccctggtacctccacttgtgtgtgtgagt |
165 |
Q |
| |
|
|||||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
19392210 |
tgaccggggttcgaaccccggctcctccacttgtgtgtgtgagt |
19392167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #134
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 34123408 - 34123524
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| ||| |||||||| ||||||||||| | ||| ||| | | ||||| ||||| ||||||||| |||| ||| || || |
|
|
| T |
34123408 |
atccagaagtcctagctcaattggtaaaatgtcaaaattgttagggca----atgacataatcagggtttgaaccatggtacctctacttatgtatgaga |
34123503 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
34123504 |
gtttataatggctttgtcatt |
34123524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #135
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 114 - 169
Target Start/End: Complemental strand, 35463888 - 35463834
Alignment:
| Q |
114 |
ggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttat |
169 |
Q |
| |
|
||||| |||||| | ||||||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
35463888 |
ggatgtcatgactgtggttcgaaccccggtacctccactt-tgtgtgtgagtttat |
35463834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #136
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 64 - 173
Target Start/End: Original strand, 54086010 - 54086116
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
||||| |||| |||||||| ||| |||||| ||||||||||| | ||||| |||||| |||||||||||||| ||||||||||| | ||| ||| |
|
|
| T |
54086010 |
atccaaaagtcctagctcaactgacaaaataccgaaattgtta---agtcggataccatgatcggggttcgaaccccaatacctccacttatatgtatga |
54086106 |
T |
 |
| Q |
164 |
gtttataatg |
173 |
Q |
| |
|
|||||||||| |
|
|
| T |
54086107 |
gtttataatg |
54086116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #137
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 143 - 178
Target Start/End: Complemental strand, 55853380 - 55853345
Alignment:
| Q |
143 |
tacctccacttgtgtgtgtgagtttataatggcttt |
178 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| |
|
|
| T |
55853380 |
tacctccacttatgtgtgtgagtttataatggcttt |
55853345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #138
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 89 - 172
Target Start/End: Original strand, 30922503 - 30922583
Alignment:
| Q |
89 |
aaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataat |
172 |
Q |
| |
|
|||||||||||||||||| |||| ||| ||||| || |||||||||| | ||||||||||||||||||| | |||||||| |
|
|
| T |
30922503 |
aaaatgtcgaaattgttatgccga---atgtcatgataggagttcgaaccccgatacctccacttgtgtgtgtaaatttataat |
30922583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #139
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 130 - 171
Target Start/End: Complemental strand, 38173436 - 38173395
Alignment:
| Q |
130 |
gttcgaaccctggtacctccacttgtgtgtgtgagtttataa |
171 |
Q |
| |
|
||||||| || ||| ||||||||||||||||||||||||||| |
|
|
| T |
38173436 |
gttcgaatcccggtgcctccacttgtgtgtgtgagtttataa |
38173395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #140
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 63 - 173
Target Start/End: Complemental strand, 52303226 - 52303121
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
|||||| |||| ||| ||| ||| ||||||| ||||||||||||| || |||| |||| ||||||||||| || |||||||||||| ||| |||| |
|
|
| T |
52303226 |
tatccaaaagtcttagttcaactgacaaaatgctgaaattgttaggctgg---atgctatgatcggggttcgaatcccggtacctccact--tgtatgtg |
52303132 |
T |
 |
| Q |
163 |
agtttataatg |
173 |
Q |
| |
|
||||||||||| |
|
|
| T |
52303131 |
agtttataatg |
52303121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #141
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 144 - 184
Target Start/End: Original strand, 23766136 - 23766176
Alignment:
| Q |
144 |
acctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||| |||||||||||||||||| ||||| |||| |
|
|
| T |
23766136 |
acctccacttgagtgtgtgagtttataatgcctttgccatt |
23766176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #142
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 64 - 111
Target Start/End: Complemental strand, 35273436 - 35273388
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaa-tgtcgaaattgttaggccg |
111 |
Q |
| |
|
||||| |||| |||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
35273436 |
atccacaagtcctagctcaactggcaaaaatgtcgaaattgttaggccg |
35273388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0008 (Bit Score: 81; Significance: 4e-38; HSPs: 1)
Name: scaffold0008
Description:
Target: scaffold0008; HSP #1
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 64 - 178
Target Start/End: Complemental strand, 39442 - 39331
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| |||| |||||| ||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
39442 |
atccagaagtcctagctcaactggtaaaatgccgaaattgttaggccgg---atgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtga |
39346 |
T |
 |
| Q |
164 |
gtttataatggcttt |
178 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
39345 |
gtttataatggcttt |
39331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0595 (Bit Score: 79; Significance: 7e-37; HSPs: 1)
Name: scaffold0595
Description:
Target: scaffold0595; HSP #1
Raw Score: 79; E-Value: 7e-37
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 344 - 461
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
||||| |||| |||||||| ||||||| ||| ||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
344 |
atccaaaagtcctagctcaactggcaatatgccgaaattgttaggccgg---atgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtga |
440 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
441 |
gtttataatggctttgccatt |
461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0778 (Bit Score: 76; Significance: 4e-35; HSPs: 1)
Name: scaffold0778
Description:
Target: scaffold0778; HSP #1
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 68 - 184
Target Start/End: Original strand, 821 - 935
Alignment:
| Q |
68 |
agaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgag-tt |
166 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||| |||||||||||||||||||| || |
|
|
| T |
821 |
agaagtcctagctcaactggcaaaatgtcgaaattgttaggccgg---atgccatgaccggggttcgaaccccggtgcctccacttgtgtgtgtgagttt |
917 |
T |
 |
| Q |
167 |
tataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||| |||| |
|
|
| T |
918 |
tataatggctttgccatt |
935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0432 (Bit Score: 76; Significance: 4e-35; HSPs: 1)
Name: scaffold0432
Description:
Target: scaffold0432; HSP #1
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 9366 - 9484
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| |||||||| ||||||||||| ||||||||||||||||| |||||||||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
9366 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccgg---atgccatgaccggggttcgaaccccggtgcctccacttgtgtgtgtga |
9462 |
T |
 |
| Q |
164 |
g-tttataatggctttggcatt |
184 |
Q |
| |
|
| ||||||||||||||| |||| |
|
|
| T |
9463 |
gttttataatggctttgccatt |
9484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0013 (Bit Score: 76; Significance: 4e-35; HSPs: 1)
Name: scaffold0013
Description:
Target: scaffold0013; HSP #1
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 63 - 184
Target Start/End: Original strand, 90567 - 90685
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| |||||||| ||||||||||| ||||||||||||||| | ||| ||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
90567 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggcctg---atgtcatgatcggggttcgaaccccggtacctccacttgtgtgtgtg |
90663 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
90664 |
agtttataatggctttgccatt |
90685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0515 (Bit Score: 72; Significance: 1e-32; HSPs: 1)
Name: scaffold0515
Description:
Target: scaffold0515; HSP #1
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 63 - 184
Target Start/End: Original strand, 2476 - 2594
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| || |||| ||| ||||||||||||||||||||||||| |||| ||||||||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
2476 |
tatccagaagtcataactcaactgacaaaatgtcgaaattgttaggccgg---atgctatgaccggggttcgaaccccggtacctccacttatgtgtgtg |
2572 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
2573 |
agtttataatggctttgccatt |
2594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0306 (Bit Score: 72; Significance: 1e-32; HSPs: 1)
Name: scaffold0306
Description:
Target: scaffold0306; HSP #1
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 63 - 184
Target Start/End: Original strand, 2476 - 2594
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| || |||| ||| ||||||||||||||||||||||||| |||| ||||||||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
2476 |
tatccagaagtcataactcaactgacaaaatgtcgaaattgttaggccgg---atgctatgaccggggttcgaaccccggtacctccacttatgtgtgtg |
2572 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
2573 |
agtttataatggctttgccatt |
2594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0882 (Bit Score: 67; Significance: 9e-30; HSPs: 1)
Name: scaffold0882
Description:
Target: scaffold0882; HSP #1
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 76 - 184
Target Start/End: Complemental strand, 3814 - 3709
Alignment:
| Q |
76 |
tagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggc |
175 |
Q |
| |
|
||||||| ||||||||||| ||||||||||||||||| |||| ||||| |||||||||||||| |||||||||||||||||||||||||||||||| | |
|
|
| T |
3814 |
tagctcaactggcaaaatgccgaaattgttaggccgg---atgctatgactggggttcgaacccttgtacctccacttgtgtgtgtgagtttataatgac |
3718 |
T |
 |
| Q |
176 |
tttggcatt |
184 |
Q |
| |
|
|||| |||| |
|
|
| T |
3717 |
tttgccatt |
3709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 67; Significance: 9e-30; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 411647 - 411764
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||| ||||||||| |||| ||||||||||||| ||||||||||| ||| ||| |||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
411647 |
atcctgaagttctaactcaactggcaaaatgtcaaaattgttaggtcgg---atgtcatgaccggggttcgaaccccagtacctccacttgtgtgtgtga |
411743 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||||||| |||| |
|
|
| T |
411744 |
ttttataatggctttgccatt |
411764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: scaffold0179
Description:
Target: scaffold0179; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 63 - 184
Target Start/End: Complemental strand, 4145 - 4026
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
||||||||||| |||||||| ||||||||||| ||||||||||| ||||| |||||||||| ||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
4145 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaagccgg---atgccatgactggggttcgaaccccggtgcctccacttgtgtgtgta |
4049 |
T |
 |
| Q |
163 |
ag-tttataatggctttggcatt |
184 |
Q |
| |
|
|| ||||||||||||||| |||| |
|
|
| T |
4048 |
agttttataatggctttgtcatt |
4026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0061 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: scaffold0061
Description:
Target: scaffold0061; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 64 - 178
Target Start/End: Complemental strand, 8988 - 8877
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| ||||||| ||||||||||| ||||||||||||||||| ||| |||||||| ||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
8988 |
atccagaagtcatagctcaactggcaaaatgccgaaattgttaggccgg---atgtcatgaccgaggttcgaaccccggtaccttcacttgtgtgtgtga |
8892 |
T |
 |
| Q |
164 |
gtttataatggcttt |
178 |
Q |
| |
|
||||| ||||||||| |
|
|
| T |
8891 |
gtttaaaatggcttt |
8877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0244 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: scaffold0244
Description:
Target: scaffold0244; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 64 - 184
Target Start/End: Complemental strand, 7886 - 7769
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
163 |
Q |
| |
|
|||||||||| ||||||| |||||||||| |||||||||||| |||||| |||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
7886 |
atccagaagtcttagctcaattggcaaaatgccgaaattgttag---atcggatgtcatgaccggggttcgaaccccgatacctccacttgtgtgtgtga |
7790 |
T |
 |
| Q |
164 |
gtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
7789 |
gtttataatggctttgccatt |
7769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 62; Significance: 9e-27; HSPs: 1)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 63 - 184
Target Start/End: Original strand, 160445 - 160565
Alignment:
| Q |
63 |
tatccagaagttctagctcagctggcaaaa-tgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgt |
161 |
Q |
| |
|
||||||||||| |||||||| |||| |||| || ||||||||||||||||| |||||||||||||||||||||||| ||| ||| ||||||||||||| |
|
|
| T |
160445 |
tatccagaagtcctagctcaactggtaaaaatgccgaaattgttaggccgg---atgccatgaccggggttcgaaccccggtgccttcacttgtgtgtgt |
160541 |
T |
 |
| Q |
162 |
gag-tttataatggctttggcatt |
184 |
Q |
| |
|
||| ||||||||||||||| |||| |
|
|
| T |
160542 |
gagttttataatggctttgccatt |
160565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0457 (Bit Score: 61; Significance: 4e-26; HSPs: 1)
Name: scaffold0457
Description:
Target: scaffold0457; HSP #1
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 68 - 178
Target Start/End: Original strand, 6782 - 6889
Alignment:
| Q |
68 |
agaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagttt |
167 |
Q |
| |
|
|||||| |||||||| ||||||||||| ||||||||||||||||| ||| |||||||||||||||||| | ||||||||||||| ||||||||| ||| |
|
|
| T |
6782 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccgg---atgtcatgaccggggttcgaactccggtacctccacttatgtgtgtgaattt |
6878 |
T |
 |
| Q |
168 |
ataatggcttt |
178 |
Q |
| |
|
||||| ||||| |
|
|
| T |
6879 |
ataatagcttt |
6889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0163 (Bit Score: 58; Significance: 2e-24; HSPs: 2)
Name: scaffold0163
Description:
Target: scaffold0163; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 62 - 174
Target Start/End: Complemental strand, 27048 - 26937
Alignment:
| Q |
62 |
atatccagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccact--tgtgtgt |
159 |
Q |
| |
|
||||||| ||||||||||||| ||||||||||| ||||||||||||| ||||||||||||| | ||| ||||||||||||||||||| ||||||| |
|
|
| T |
27048 |
atatccataagttctagctcaactggcaaaatgcagaaattgttaggc---cggatgccatgactagagtttgaaccctggtacctccacttatgtgtgt |
26952 |
T |
 |
| Q |
160 |
gtgagtttataatgg |
174 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
26951 |
gtgagtttataatgg |
26937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0163; HSP #2
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 70 - 173
Target Start/End: Complemental strand, 5595 - 5495
Alignment:
| Q |
70 |
aagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttat |
169 |
Q |
| |
|
||||||||||||| |||||| |||| ||||||||||| | |||||| ||||| ||||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
5595 |
aagttctagctcaactggcagaatgccgaaattgtta---tgtcggatgtcatgatcggggtttgaaccctgatacctccacttgtgtgtgtgagtttat |
5499 |
T |
 |
| Q |
170 |
aatg |
173 |
Q |
| |
|
|||| |
|
|
| T |
5498 |
aatg |
5495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0014 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: scaffold0014
Description:
Target: scaffold0014; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 64 - 184
Target Start/End: Original strand, 195739 - 195857
Alignment:
| Q |
64 |
atccagaagttctagctcagctggcaaaa-tgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtg |
162 |
Q |
| |
|
|||||||||| |||| ||| || |||||| |||||||||||||||||||| || |||||| ||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
195739 |
atccagaagtcctagttcaactagcaaaaatgtcgaaattgttaggccgg---atttcatgactggggttcgaaccccggttcctccacttgtgtgtgtg |
195835 |
T |
 |
| Q |
163 |
agtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||||| ||||| |||| |
|
|
| T |
195836 |
agtttataatgactttgtcatt |
195857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057 (Bit Score: 54; Significance: 5e-22; HSPs: 1)
Name: scaffold0057
Description:
Target: scaffold0057; HSP #1
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 97 - 184
Target Start/End: Original strand, 64315 - 64399
Alignment:
| Q |
97 |
gaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||||||||| |||||||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
64315 |
gaaattgttaggccgg---atgccatgaccggagttcgaaccccagtacctccacttgtgtgtgtgagtttataatgactttgtcatt |
64399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0364 (Bit Score: 51; Significance: 3e-20; HSPs: 1)
Name: scaffold0364
Description:
Target: scaffold0364; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 67 - 179
Target Start/End: Original strand, 11980 - 12089
Alignment:
| Q |
67 |
cagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtt |
166 |
Q |
| |
|
||||||| ||||||| ||| |||||||||||||| |||| |||| |||||||||||| ||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
11980 |
cagaagtcgtagctcaattggtaaaatgtcgaaattattagaccgg---atgccatgaccgatgttcgaacctcggtaccttcacttgtgtgtgtgagtt |
12076 |
T |
 |
| Q |
167 |
tataatggctttg |
179 |
Q |
| |
|
||||||||||||| |
|
|
| T |
12077 |
tataatggctttg |
12089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0502 (Bit Score: 49; Significance: 5e-19; HSPs: 1)
Name: scaffold0502
Description:
Target: scaffold0502; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 128 - 184
Target Start/End: Original strand, 10575 - 10631
Alignment:
| Q |
128 |
gggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
10575 |
gggttcgaaccccggtacctccacttgtgtgtgtgagtttataatggctttgccatt |
10631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0122 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: scaffold0122
Description:
Target: scaffold0122; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 68 - 184
Target Start/End: Original strand, 18058 - 18171
Alignment:
| Q |
68 |
agaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagttt |
167 |
Q |
| |
|
|||||| ||| |||| |||||||||| ||||||||||| ||||| ||||||||| ||||||| |||||| | ||||||||||| | |||| ||||| |
|
|
| T |
18058 |
agaagtcctacctcaactggcaaaataccgaaattgttaagccgg---atgccatgatcggggtttgaaccccgatacctccacttataagtgtaagttt |
18154 |
T |
 |
| Q |
168 |
ataatggctttggcatt |
184 |
Q |
| |
|
|||||||||||| |||| |
|
|
| T |
18155 |
ataatggctttgccatt |
18171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0041 (Bit Score: 42; Significance: 0.000000000000008; HSPs: 1)
Name: scaffold0041
Description:
Target: scaffold0041; HSP #1
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 75 - 184
Target Start/End: Complemental strand, 93086 - 92981
Alignment:
| Q |
75 |
ctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacct-ccacttgtgtgtgtgagtttataatg |
173 |
Q |
| |
|
|||||||| | || |||||| ||||||| |||||| || |||||||||||||||||||||||| ||||||| ||||| ||||||||||||||||||| |
|
|
| T |
93086 |
ctagctcaaccggtaaaatgccgaaattattaggctgg---atgccatgaccggggttcgaaccccggtacctcccact--tgtgtgtgagtttataatg |
92992 |
T |
 |
| Q |
174 |
gctttggcatt |
184 |
Q |
| |
|
||||| |||| |
|
|
| T |
92991 |
cctttgtcatt |
92981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0010 (Bit Score: 42; Significance: 0.000000000000008; HSPs: 1)
Name: scaffold0010
Description:
Target: scaffold0010; HSP #1
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 126 - 179
Target Start/End: Original strand, 27930 - 27983
Alignment:
| Q |
126 |
cggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttg |
179 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
27930 |
cggggttcgaaccccggtacctccacttgtgtgtgtgagttcataatgactttg |
27983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0131 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: scaffold0131
Description:
Target: scaffold0131; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 114 - 184
Target Start/End: Complemental strand, 29943 - 29874
Alignment:
| Q |
114 |
ggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
|||||| || ||||||||||||| || | |||||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
29943 |
ggatgcaatcaccggggttcgaatcc-gatacctccacttgtgtgtgtgggtttataatggctttgccatt |
29874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0684 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: scaffold0684
Description:
Target: scaffold0684; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 116 - 173
Target Start/End: Original strand, 2209 - 2266
Alignment:
| Q |
116 |
atgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatg |
173 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
2209 |
atgccatgaccgaagttttaaccttggtacctccacttgtgtgtgtgagtttataatg |
2266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0070 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: scaffold0070
Description:
Target: scaffold0070; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 86 - 184
Target Start/End: Original strand, 42073 - 42166
Alignment:
| Q |
86 |
ggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggctttggcatt |
184 |
Q |
| |
|
||||||||| | ||||||||||||||| | ||||||| |||||||||||||| |||| ||| ||| ||||||||||||||||| ||||||| |||| |
|
|
| T |
42073 |
ggcaaaatgccaaaattgttaggccgg---acgccatgatcggggttcgaaccccggtatctctact--tgtgtgtgagtttataacggctttgccatt |
42166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0242 (Bit Score: 37; Significance: 0.000000000008; HSPs: 2)
Name: scaffold0242
Description:
Target: scaffold0242; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 67 - 184
Target Start/End: Original strand, 15060 - 15172
Alignment:
| Q |
67 |
cagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtt |
166 |
Q |
| |
|
||||||| ||||||| ||| |||||| |||||||||||||||| ||| |||||||| |||||||||| |||||||||||||||||||| ||| |
|
|
| T |
15060 |
cagaagtcttagctcaactgataaaatgccgaaattgttaggccga---atgtcatgaccgaggttcgaacctctgtacctccacttgtgtgtgt--gtt |
15154 |
T |
 |
| Q |
167 |
tataatggctttggcatt |
184 |
Q |
| |
|
||||||| ||||| |||| |
|
|
| T |
15155 |
tataatgactttgtcatt |
15172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0242; HSP #2
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 67 - 184
Target Start/End: Original strand, 23895 - 24007
Alignment:
| Q |
67 |
cagaagttctagctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtt |
166 |
Q |
| |
|
||||||| ||||||| ||| |||||| |||||||||||||||| ||| |||||||| |||||||||| |||||||||||||||||||| ||| |
|
|
| T |
23895 |
cagaagtcttagctcaactgataaaatgccgaaattgttaggccga---atgtcatgaccgaggttcgaacctctgtacctccacttgtgtgtgt--gtt |
23989 |
T |
 |
| Q |
167 |
tataatggctttggcatt |
184 |
Q |
| |
|
||||||| ||||| |||| |
|
|
| T |
23990 |
tataatgactttgtcatt |
24007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0548 (Bit Score: 33; Significance: 0.000000002; HSPs: 2)
Name: scaffold0548
Description:
Target: scaffold0548; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 89 - 159
Target Start/End: Original strand, 6772 - 6838
Alignment:
| Q |
89 |
aaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgt |
159 |
Q |
| |
|
|||||| ||||||||||||||||| ||| |||||| ||||||||||| | ||||||||||||||||||| |
|
|
| T |
6772 |
aaaatgccgaaattgttaggccgg---atgtcatgac-ggggttcgaactccggtacctccacttgtgtgt |
6838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0548; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 142 - 178
Target Start/End: Original strand, 8172 - 8208
Alignment:
| Q |
142 |
gtacctccacttgtgtgtgtgagtttataatggcttt |
178 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| |
|
|
| T |
8172 |
gtacctccacttatgtgtgtgagtttataatggcttt |
8208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0160 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0160
Description:
Target: scaffold0160; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 120 - 179
Target Start/End: Original strand, 22134 - 22194
Alignment:
| Q |
120 |
catgaccggggttcgaaccctggtacctccac-ttgtgtgtgtgagtttataatggctttg |
179 |
Q |
| |
|
||||| |||||||||||||| | ||||||||| |||||||||||||||||| ||| ||||| |
|
|
| T |
22134 |
catgatcggggttcgaaccccgatacctccactttgtgtgtgtgagtttatgatgactttg |
22194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0204 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: scaffold0204
Description:
Target: scaffold0204; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 115 - 178
Target Start/End: Original strand, 2801 - 2864
Alignment:
| Q |
115 |
gatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggcttt |
178 |
Q |
| |
|
|||| |||||| ||||||||||| || ||||||||||| ||||||| |||||| ||||||||| |
|
|
| T |
2801 |
gatgtcatgactggggttcgaactttgatacctccacttatgtgtgtaagtttacaatggcttt |
2864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0036 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0036
Description:
Target: scaffold0036; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 70 - 112
Target Start/End: Original strand, 95154 - 95196
Alignment:
| Q |
70 |
aagttctagctcagctggcaaaatgtcgaaattgttaggccgg |
112 |
Q |
| |
|
||||||||| ||| ||||||||||| ||||||||||||||||| |
|
|
| T |
95154 |
aagttctagttcaactggcaaaatgccgaaattgttaggccgg |
95196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0795 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0795
Description:
Target: scaffold0795; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 77 - 184
Target Start/End: Original strand, 1072 - 1176
Alignment:
| Q |
77 |
agctcagctggcaaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataatggct |
176 |
Q |
| |
|
|||||| |||| |||||| ||||||||||||| ||| ||| ||||| ||||||| ||||| ||||| || ||||||||||||||||||||| || |
|
|
| T |
1072 |
agctcaactggtaaaatgccgaaattgttaggtcgg---atgttatgactggggttccaaccccaataccttcatgtgtgtgtgtgagtttataatgact |
1168 |
T |
 |
| Q |
177 |
ttggcatt |
184 |
Q |
| |
|
||| |||| |
|
|
| T |
1169 |
ttgccatt |
1176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0223 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0223
Description:
Target: scaffold0223; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 89 - 179
Target Start/End: Original strand, 22944 - 23032
Alignment:
| Q |
89 |
aaaatgtcgaaattgttaggccggcggatgccatgaccggggttcgaaccctggtacctccac-ttgtgtgtgtgagtttataatggctttg |
179 |
Q |
| |
|
|||||| |||||||||||||| |||| | |||||| | || |||||||| ||||||||||| |||||||| ||||||||| |||| |||| |
|
|
| T |
22944 |
aaaatgccgaaattgttaggc---cggacgtcatgactgaggatcgaaccccggtacctccactttgtgtgtttgagtttatgatggttttg |
23032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University