View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8651_high_9 (Length: 281)
Name: NF8651_high_9
Description: NF8651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8651_high_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 138; Significance: 3e-72; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 124 - 261
Target Start/End: Complemental strand, 32588701 - 32588564
Alignment:
| Q |
124 |
atgtttatgcgtgtttgtgagggaattttaaaacggatatagtagcatatgtaagacgacttggttgggacaagatggggtgactaattgttccatttta |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32588701 |
atgtttatgcgtgtttgtgagggaattttaaaacggatatagtagcatatgtaagacgacttggttgggacaagatggggtgactaattgttccatttta |
32588602 |
T |
 |
| Q |
224 |
ttgaacctacctttcgttatctttgtattgacactttt |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32588601 |
ttgaacctacctttcgttatctttgtattgacactttt |
32588564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 1 - 29
Target Start/End: Complemental strand, 32588824 - 32588796
Alignment:
| Q |
1 |
acttcaggaatcaaactatcacattaatg |
29 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
32588824 |
acttcaggaatcaaactatcacattaatg |
32588796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University