View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8651_low_13 (Length: 310)
Name: NF8651_low_13
Description: NF8651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8651_low_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 276; Significance: 1e-154; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 17 - 300
Target Start/End: Complemental strand, 36392172 - 36391889
Alignment:
| Q |
17 |
acttcagtagaactgctattggggaatttgatccctcattatttcaattagaaaatctcaaaaggttatctccaagtggatgtggttggccaggttccaa |
116 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
36392172 |
acttcagtagaactgctgttggggaatttgatccctcattatttcaattagaaaatctcaaaaggttatctctaagtggatgtggttggccaggttccaa |
36392073 |
T |
 |
| Q |
117 |
ctctggacgagatttgattctgccatatgatttcaaaaccttttgtgtgtccgaaaattgtggttcataccgagtttcaaggtccgtgcacaagctaact |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36392072 |
ctctggacgagatttgattctgccatatgatttcaaaaccttttgtgtgtccgaaaattgtggttcataccgagtttcaaggtccgtgcacaagctaact |
36391973 |
T |
 |
| Q |
217 |
tttacaatctacacagaagtgattgtggatcatgaatttttatttctggtgaacacttttccatttacacctcctccatctctg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36391972 |
tttacaatctacacagaagtgattgtggatcatgaatttttatttctggtgaacacttttccatttacacctcctccatctctg |
36391889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 169 - 300
Target Start/End: Original strand, 36389179 - 36389312
Alignment:
| Q |
169 |
gaaaattgtggttcataccgagtttcaaggtccgtgcacaagctaacttttacaatctacacagaagtgattgtggatcatgaatttttatttctggtga |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| | ||||||||||||||||||||| ||||| |
|
|
| T |
36389179 |
gaaaattgtggttcataccgagtttcaaggtccgtgcacaagctaacttttacaatctacacggaagtgactatggatcatgaatttttatttccggtga |
36389278 |
T |
 |
| Q |
269 |
acactttt--ccatttacacctcctccatctctg |
300 |
Q |
| |
|
|| |||| | ||||||||||||||||||||| |
|
|
| T |
36389279 |
acgttttttctcgtttacacctcctccatctctg |
36389312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University