View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8651_low_15 (Length: 286)
Name: NF8651_low_15
Description: NF8651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8651_low_15 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 7 - 258
Target Start/End: Complemental strand, 25377986 - 25377736
Alignment:
| Q |
7 |
cagagagatagagaggtggtttatttaaggtcggtttttggtaattaaagcagaaaggagaagaccgactaggccctaacttcattcaatcttcaagtaa |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25377986 |
cagagagatagagaggtggtttatttaaggtcggtttt-ggtaattaaagcagaaaggagaagaccgactaggccctaacttcattcaatcttcaagtaa |
25377888 |
T |
|
| Q |
107 |
tagaagaattactcgcttgtgacttaaggcggaacaatgaagcttataactattgtagaccaaacatgagtaatcattatactactctaaacagcatgga |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25377887 |
tagaagaattactcgcttgtgacttaaggcggaacaatgaagcttataactattgtagaccaaacatgagtaatcattatactactctaaacagcatgga |
25377788 |
T |
|
| Q |
207 |
ttaatttgatcaccacttcaatttcttcaaacaactatgccaagaagtgtta |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25377787 |
ttaatttgatcaccacttcaatttcttcaaacaactatgccaagaagtgtta |
25377736 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University