View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8651_low_32 (Length: 221)

Name: NF8651_low_32
Description: NF8651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8651_low_32
NF8651_low_32
[»] chr5 (1 HSPs)
chr5 (57-197)||(4964487-4964627)
[»] chr8 (1 HSPs)
chr8 (142-205)||(25220561-25220624)


Alignment Details
Target: chr5 (Bit Score: 89; Significance: 5e-43; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 57 - 197
Target Start/End: Complemental strand, 4964627 - 4964487
Alignment:
57 gttaaatcatatctctttctctgtgatgctatgctactaacttcttcacccctgtgttacttccattattacatgaaagccattttta--cactctgaat 154  Q
    |||||||| |||||||||||||||||| |||  ||||||||||||||||||||||| |||||||||||||||||||| ||||| ||||  ||| ||||||    
4964627 gttaaatcctatctctttctctgtgatacta--ctactaacttcttcacccctgtgctacttccattattacatgaaggccatctttatacacactgaat 4964530  T
155 tatcagataaattcaactatcttttttaactttttcccataag 197  Q
    |  ||||||||||||||||||||||||||||||||||||||||    
4964529 ttgcagataaattcaactatcttttttaactttttcccataag 4964487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 60; Significance: 9e-26; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 142 - 205
Target Start/End: Complemental strand, 25220624 - 25220561
Alignment:
142 ttacactctgaattatcagataaattcaactatcttttttaactttttcccataaggtgtgttt 205  Q
    |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
25220624 ttacactctgaattgtcagataaattcaactatcttttttaactttttcccataaggtgtgttt 25220561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University