View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8651_low_34 (Length: 213)
Name: NF8651_low_34
Description: NF8651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8651_low_34 |
 | |
|
| [»] scaffold0405 (2 HSPs) |
| | |
|
Alignment Details
Target: chr5 (Bit Score: 66; Significance: 2e-29; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 16 - 81
Target Start/End: Complemental strand, 9695453 - 9695388
Alignment:
| Q |
16 |
cagagctttccattcctttccaccggctttcccaacctgattcaaattcaccgtaaatcacgttag |
81 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9695453 |
cagagctttccattcctttccaccggctttcccaacctgattcaaattcaccgtaaatcacgttag |
9695388 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 65; E-Value: 9e-29
Query Start/End: Original strand, 137 - 201
Target Start/End: Complemental strand, 9695332 - 9695268
Alignment:
| Q |
137 |
gcgtcagaaatctcaccacagcaacggacttgttgcttggattctccttcttgaacctctctctg |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9695332 |
gcgtcagaaatctcaccacagcaacggacttgttgcttggattctccttcttgaacctctctctg |
9695268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 23 - 81
Target Start/End: Original strand, 30440131 - 30440189
Alignment:
| Q |
23 |
ttccattcctttccaccggctttcccaacctgattcaaattcaccgtaaatcacgttag |
81 |
Q |
| |
|
||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
30440131 |
ttccattcctttccaccaactttcccaacctaattcaaattcaccgtaaatcacgttag |
30440189 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0405 (Bit Score: 38; Significance: 0.000000000001; HSPs: 2)
Name: scaffold0405
Description:
Target: scaffold0405; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 135 - 200
Target Start/End: Original strand, 15174 - 15239
Alignment:
| Q |
135 |
tcgcgtcagaaatctcaccacagcaacggacttgttgcttggattctccttcttgaacctctctct |
200 |
Q |
| |
|
|||| ||| ||| ||||||||| ||||||| |||||||||| |||||| ||||||||||||||||| |
|
|
| T |
15174 |
tcgcttcacaaaactcaccacaacaacggatttgttgcttgaattctctttcttgaacctctctct |
15239 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0405; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 27 - 67
Target Start/End: Original strand, 15071 - 15111
Alignment:
| Q |
27 |
attcctttccaccggctttcccaacctgattcaaattcacc |
67 |
Q |
| |
|
|||| |||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
15071 |
attcttttccaccagctttcccaacctaattcaaattcacc |
15111 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University