View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8651_low_36 (Length: 209)
Name: NF8651_low_36
Description: NF8651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8651_low_36 |
 | |
|
| [»] scaffold0032 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0032 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: scaffold0032
Description:
Target: scaffold0032; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 15 - 193
Target Start/End: Complemental strand, 44278 - 44100
Alignment:
| Q |
15 |
actccacaagcaacacatgttcattgcacaaaacaggtttaggtagcttgaatacttgcaaccgattttcctgtacaatatgtcaccagaacattcaagt |
114 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44278 |
actccactagcaacacatgttcattgcacaaaacaggtttaggtagcttgaatacttgcaaccgattttcctgtacaatatgtcaccagaacattcaagt |
44179 |
T |
|
| Q |
115 |
tacgtacacatgaaaagatttctgtgcgttataacatgcagtttgaaatggataaatttcaacaggtacaaggggtatt |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44178 |
tacgtacacatgaaaagatttctgtgcgttaaaacatgcagtttgaaatggataaatttcaacaggtacaaggggtatt |
44100 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 62; Significance: 6e-27; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 23 - 136
Target Start/End: Original strand, 28700023 - 28700135
Alignment:
| Q |
23 |
agcaacacatgttcattgcacaaaacaggtttaggtagcttgaatacttgcaaccgattttcctgtacaatatgtcaccagaacattcaagttacgtaca |
122 |
Q |
| |
|
|||| |||| || ||||||||||||||||||||||||||||||||| || || |||||||||||||||||||||||||||||| |||||||||| ||| |
|
|
| T |
28700023 |
agcagcacacgtccattgcacaaaacaggtttaggtagcttgaataattcca-ccgattttcctgtacaatatgtcaccagaattttcaagttacacaca |
28700121 |
T |
|
| Q |
123 |
catgaaaagatttc |
136 |
Q |
| |
|
||||| ||||||| |
|
|
| T |
28700122 |
catgatgagatttc |
28700135 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University