View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8652_low_3 (Length: 313)
Name: NF8652_low_3
Description: NF8652
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8652_low_3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 16 - 304
Target Start/End: Original strand, 34326202 - 34326491
Alignment:
| Q |
16 |
cagttcttaatcgcagttgcggtcttagttgcagttgtgctgcaaaccttgatattgaggcaaaatgcggccgcaattacagttacaatgcagttgcaga |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
34326202 |
cagttcttaatcgcagttgcggtcttagttgcagttgttctgcaaaccttgatattgaggcaaaacgcggccgcaattacagttacaatgcagttgcaga |
34326301 |
T |
|
| Q |
116 |
aatctctaaaatagttacattgcggctgcagttgtagtttggactgcaatttagaactacgattttaatgatgtcggact-aaaggtcgatagataaata |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
34326302 |
aatctctaaaatagttacattgcggctgcagttgtagtttggactgcaatttggaactacgattttaatgatgtcggactaaaaggtcgatagataaata |
34326401 |
T |
|
| Q |
215 |
cctcggcccatgtttccatggtatatgaaaagcctggtggcttatctgatgctccaaaaccaagaagatcaatagcataaacagtataat |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34326402 |
cctcggcccatgtttccatggtatatgaaaagcctggtggcttatctgatgctccaaaaccaagaagatcaatagcataaacagtataat |
34326491 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University