View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8652_low_4 (Length: 236)
Name: NF8652_low_4
Description: NF8652
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8652_low_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 104; Significance: 6e-52; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 90 - 220
Target Start/End: Complemental strand, 10984657 - 10984529
Alignment:
| Q |
90 |
tcaatatctcatctcttgcgtaatatggtacttttgacttacaattgggtcttgagacagatttttcccaagttgtctggatatcaattattctttgtga |
189 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
10984657 |
tcaatatctcatctcttccgtaaaatggtacttttgacttacaattgggtcttgacacagaattttcccaagttgtctggatatcaattattc--tgtga |
10984560 |
T |
 |
| Q |
190 |
attggcttcatagcaccatctttattggatg |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
10984559 |
attggcttcatagcaccatctttattggatg |
10984529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 17 - 56
Target Start/End: Complemental strand, 10984697 - 10984658
Alignment:
| Q |
17 |
tgtgtgtaaaatgcctcacgtgtggcagcataaatgaggg |
56 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
10984697 |
tgtgtgtaaaatgcctgacgtgtggcagcataaatgaggg |
10984658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University