View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8652_low_5 (Length: 223)

Name: NF8652_low_5
Description: NF8652
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8652_low_5
NF8652_low_5
[»] chr5 (2 HSPs)
chr5 (108-223)||(2956403-2956518)
chr5 (11-107)||(2955492-2955587)


Alignment Details
Target: chr5 (Bit Score: 100; Significance: 1e-49; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 108 - 223
Target Start/End: Original strand, 2956403 - 2956518
Alignment:
Q  108 taagatgtgaaaatcaagcttgttttgtgctcttccaaatactaaactatggatttagatagcaaactcaatgtgcttaggggtaagtgaataatatgtt 207  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||| ||||||||    
T  2956403 taagatgtgcaaatcaagcttgttttgtgctcttccaaatactaaactatggatgtagatagcaaactcaacgtgcttaggggtaagtgaaaaatatgtt 2956502  T
Q  208 cctttaacattgtttt 223  Q
    ||||||||||||||||    
T  2956503 cctttaacattgtttt 2956518  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 11 - 107
Target Start/End: Original strand, 2955492 - 2955587
Alignment:
Q  11 tgttaactggggtattgatttattgtttcagaaactataatattttcctttttcaaatctcaacgtctaaatcttaccttatgaatggttcttacgt 107  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||    
T  2955492 tgttaactggggtattgatttattgtttcataaactataatattttcctttgtcaaatctcaacgtctaaatcttaccttatgaat-gttcttacgt 2955587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University