View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8653_low_4 (Length: 239)
Name: NF8653_low_4
Description: NF8653
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8653_low_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 3 - 223
Target Start/End: Original strand, 2608857 - 2609077
Alignment:
| Q |
3 |
ttgaagtgttgttgaatttgttacctttaaaaggatgaggctaccaattggaccaattggtttaagtgatgtttggaatggaaagaaatctaaggaaatt |
102 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
2608857 |
ttgaagtgttgttgaatttgtgaccttcaaaaggatgaggctaccaattggaccaattggtttaagtgatgtttggaatggaaagaaatctaatgaaatt |
2608956 |
T |
 |
| Q |
103 |
tcgtgccannnnnnngtgatgggattgtgagcataacaacatgatttttggtaattgcgaattggtagtgctaagaaccatggtgtagactcatgaggtt |
202 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2608957 |
tcgtgccatttttttgtgatgggattgtgagcataacaacatgatttttggtaattgcgaattggtagtgctaagaaccatggtgtagactcatgaggtt |
2609056 |
T |
 |
| Q |
203 |
tgtatttggttatgaaagttc |
223 |
Q |
| |
|
|||||||||||||| |||||| |
|
|
| T |
2609057 |
tgtatttggttatggaagttc |
2609077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University