View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8657_high_8 (Length: 281)

Name: NF8657_high_8
Description: NF8657
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8657_high_8
NF8657_high_8
[»] chr3 (1 HSPs)
chr3 (7-281)||(52624616-52624890)


Alignment Details
Target: chr3 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 7 - 281
Target Start/End: Complemental strand, 52624890 - 52624616
Alignment:
7 tttggtgttaggtgggaccatcggagctcggcgatgacaccagacgaggaggtgttttacctggtggcatttctgagatcagctttggatgctgagacac 106  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52624890 tttggtgttaggtgggaccatcggagctcggcggtgacaccagacgaggaggtgttttacctggtggcatttctgagatcagctttggatgctgagacac 52624791  T
107 tggagcacctgactaatcagaaccgtcagatcctgggattctgtcatgattcgaagataggggttaaacagtacctaccccattacacaacaatgcagga 206  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52624790 tggagcacctgactaatcagaaccgtcagatcctgggattctgtcatgattcgaagataggggttaaacagtacctaccccattacacaacaatgcagga 52624691  T
207 gtggatggaccactttggagataaatggacccaattcaatgccatgaagatgcaattcgaccctcaacgaatctt 281  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52624690 gtggatggaccactttggagataaatggacccaattcaatgccatgaagatgcaattcgaccctcaacgaatctt 52624616  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University