View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8657_low_11 (Length: 281)

Name: NF8657_low_11
Description: NF8657
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8657_low_11
NF8657_low_11
[»] chr8 (1 HSPs)
chr8 (18-274)||(28440879-28441135)


Alignment Details
Target: chr8 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 18 - 274
Target Start/End: Original strand, 28440879 - 28441135
Alignment:
18 attttggggaaaaagatgagaaatggttgcatcagaaatgaaaaatatgacacaaggatgcgtgattaccgtgatagaatactcactttttgttgaaata 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28440879 attttggggaaaaagatgagaaatggttgcatcagaaatgaaaaatatgacacaaggatgcgtgattaccgtgatagaatactcactttttgttgaaata 28440978  T
118 tacatatgaagtgtcgtttcataacatacaaagtgcaagaagctcatgacatatgcattaactctattctcccatgattcttaccacaaaacttctgtcc 217  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
28440979 tacatatgaagtgtcgtttcataacatacaaagtgcaagaagctcatgacatatgcattaactctattctcccatgattcttaccccaaaacttctgtcc 28441078  T
218 ccatcttccttttatcactttgatgatgaatagatacccaccactaactaacaccaa 274  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28441079 ccatcttccttttatcactttgatgatgaatagatacccaccactaactaacaccaa 28441135  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University