View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8657_low_19 (Length: 217)
Name: NF8657_low_19
Description: NF8657
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8657_low_19 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 58; Significance: 1e-24; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 44 - 109
Target Start/End: Complemental strand, 32831624 - 32831559
Alignment:
| Q |
44 |
atcataatcagctttgtcaaaatcatgattatttggatgctcagccatatgagagtgtgcaatatc |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
32831624 |
atcataatcagctttgtcaaaatcatgattatttggatgctcgaccatatgagagtgtgcaatatc |
32831559 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 36 - 109
Target Start/End: Complemental strand, 32844903 - 32844830
Alignment:
| Q |
36 |
ggaagtgtatcataatcagctttgtcaaaatcatgattatttggatgctcagccatatgagagtgtgcaatatc |
109 |
Q |
| |
|
|||||||||||||| ||||| | ||||| ||||||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
32844903 |
ggaagtgtatcatagccagctctatcaaattcatgattatttggatgcttagtcatatgagagtgtgcaatatc |
32844830 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 135 - 198
Target Start/End: Complemental strand, 32829695 - 32829629
Alignment:
| Q |
135 |
aagacttcaactcaatctcaac---ggctataatctacaatccctaaacactccagcatgtggtttt |
198 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
32829695 |
aagacttcaactcagtctcaacaacggctataatctacaatccctaaacactccagcacgtggtttt |
32829629 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 135 - 198
Target Start/End: Complemental strand, 32842375 - 32842312
Alignment:
| Q |
135 |
aagacttcaactcaatctcaacggctataatctacaatccctaaacactccagcatgtggtttt |
198 |
Q |
| |
|
|||||||||||| || || ||| |||||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
32842375 |
aagacttcaacttaagcttaacaactataatctacaatccttaaacactccataatgtggtttt |
32842312 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 36 - 109
Target Start/End: Original strand, 17933030 - 17933103
Alignment:
| Q |
36 |
ggaagtgtatcataatcagctttgtcaaaatcatgattatttggatgctcagccatatgagagtgtgcaatatc |
109 |
Q |
| |
|
|||||||||||||| ||||| | ||||| ||||||||||||||||||| || ||||||| ||||||||||||| |
|
|
| T |
17933030 |
ggaagtgtatcatagccagctctatcaaattcatgattatttggatgcttagtcatatgaaagtgtgcaatatc |
17933103 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University