View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8658_low_3 (Length: 244)
Name: NF8658_low_3
Description: NF8658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8658_low_3 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 20 - 172
Target Start/End: Complemental strand, 10661508 - 10661356
Alignment:
| Q |
20 |
attatcaggagtctaatcgcgcgaccaaagtgttaagagaaaaagaaaactatttaacactttcatattgtttttggcttgatattacagatgggttcaa |
119 |
Q |
| |
|
||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10661508 |
attatcaagagtctaatcgtgcgaccaaagtgttaagagaaaaagaaaactatttaacactttcatattgtttttggcttgatattacagatgggttcaa |
10661409 |
T |
 |
| Q |
120 |
ccatgaaaccaaccatttttaatgaaagattggcaacagcactcaagaaatgg |
172 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10661408 |
ccatgaaaccaaccatttttaatgaaagattggcaacagcactcaagaaatgg |
10661356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University