View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8659_high_2 (Length: 442)
Name: NF8659_high_2
Description: NF8659
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8659_high_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 410; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 410; E-Value: 0
Query Start/End: Original strand, 15 - 432
Target Start/End: Complemental strand, 7554422 - 7554005
Alignment:
| Q |
15 |
aagattatcaacaacaacactcgacgaagaattcgtagaagatgactcaagagttcgttcaagttcagcaaggtagcccgaaaaagagagggaagattga |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7554422 |
aagattatcaacaacaacactcgacgaagaattcgtagaagatgattcaagagttcgttcaagttcagcaaggtagcccgaaaaagagagggaagattga |
7554323 |
T |
 |
| Q |
115 |
aggtagagcgggctgggctctaatgaccatgttgagaaagcggttatgaagcccgtgggctcgaatgggtcttcttcttcgttggtatcggtgttggttt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7554322 |
aggtagagcgggctgggctctaatgaccatgttgagaaagcggttatgaagcccgtgggctcgaatgggtcttcttcttcgttggtatcggtgttggttt |
7554223 |
T |
 |
| Q |
215 |
ggttgagagtggggggagggagatctggtgtgacgaggcataggggattatcttgggcgcgcaggtggaagatgtggtggggatgggattgtcgttcttc |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7554222 |
ggttgagagtggggggagggagatctggtgtgacgaggcataggggattatcttgggcgcgcaggtggaagatgtggtggggatgggattgtcgttcttc |
7554123 |
T |
 |
| Q |
315 |
tacgacgcggccgcatgatgtgcattctgtgattgattttccggtggttgttgtggtgcaacgcccctgcgccgctgaacagtatgggcacttcattttt |
414 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7554122 |
tacgacgcggccgcatgatgtgcattctgtgattgattttccggtggttgttgtggtgcaacgcccctgcgccgctgaacagtatgggcacttcattttt |
7554023 |
T |
 |
| Q |
415 |
ctttctcttgtttctctg |
432 |
Q |
| |
|
|||||| ||||||||||| |
|
|
| T |
7554022 |
ctttcttttgtttctctg |
7554005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University