View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8659_low_11 (Length: 272)
Name: NF8659_low_11
Description: NF8659
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8659_low_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 18 - 259
Target Start/End: Original strand, 2895578 - 2895819
Alignment:
| Q |
18 |
cataagccactcgtgaaaactaaatttgttaatgggctgagttatcgaaaatggtgtcttccgattctggtgatggaaactttgcataggcttgctgggc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
2895578 |
cataagccactcgtgaaaactaaatttgttaatgggctgagttatcgaaaatggtgtcttccgattccggtgatggaaactttgcataggcttgctgggc |
2895677 |
T |
 |
| Q |
118 |
agcttttgtctgatttgtgtgataggaattatttctatttgtttgatgtggagtccttttttacagctaaggctttgaatatgtgtatacctggtgggcc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2895678 |
agcttttgtctgatttgtgtgataggaattatttctatttgtttgatgtggagtccttttttacagctaaggctttgaatatgtgtatacctggtgggcc |
2895777 |
T |
 |
| Q |
218 |
gaagtttgagcctctgtatcgtgacgcggagaaaggagatga |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2895778 |
gaagtttgagcctctgtatcgtgacgcggagaaaggagatga |
2895819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 67; Significance: 8e-30; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 90 - 212
Target Start/End: Complemental strand, 44785352 - 44785230
Alignment:
| Q |
90 |
atggaaactttgcataggcttgctgggcagcttttgtctgatttgtgtgataggaattatttctatttgtttgatgtggagtccttttttacagctaagg |
189 |
Q |
| |
|
|||| |||||||||| ||||||||||||||||| |||||||| | |||| || ||||||||||| |||||||| ||||||||||||||||||| |||| |
|
|
| T |
44785352 |
atggcaactttgcatcggcttgctgggcagcttctgtctgatctaagtgacagaaattatttctacttgtttgacatggagtccttttttacagcaaagg |
44785253 |
T |
 |
| Q |
190 |
ctttgaatatgtgtatacctggt |
212 |
Q |
| |
|
||||||| ||||| ||||||||| |
|
|
| T |
44785252 |
ctttgaacatgtgcatacctggt |
44785230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University