View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8659_low_6 (Length: 348)
Name: NF8659_low_6
Description: NF8659
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8659_low_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 253; Significance: 1e-140; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 253; E-Value: 1e-140
Query Start/End: Original strand, 61 - 333
Target Start/End: Original strand, 4888385 - 4888657
Alignment:
| Q |
61 |
caatatatttcttcaacctaaaatttgtttttgaaggactcattgtctcatttaaaaatgtgaaaaaggctttataaatagggttatattcaatgcaata |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4888385 |
caatatatttcttcaacctaaaatttgtttttgaaggactcattgtctcatttaaaaatgtgaaaaaggctttataaatagggttatattcaatgcaata |
4888484 |
T |
 |
| Q |
161 |
ataatattgttgctacatgaatatttttgaattaaaaacaatgtacttcttcaacttaatactaactcttgatgttaaaagacaagaagcacatttggaa |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
4888485 |
ataatattgttgctacatgaatatttttgaattaaaaacaatgtacttcttcaacttaatactaactcttgatgttaaaagacaagaagcacatgtggaa |
4888584 |
T |
 |
| Q |
261 |
tgtggatgctaatgttttatagtcttggtttaactttttcgactaaattaaaaggtattcattgaaattataa |
333 |
Q |
| |
|
|||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
4888585 |
tgtgcatgctaatgttttctagtcttggtttaactttttcgactaaattaaaaggtatacattgacattataa |
4888657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University