View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8660_low_4 (Length: 323)
Name: NF8660_low_4
Description: NF8660
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8660_low_4 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 150; Significance: 3e-79; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 150; E-Value: 3e-79
Query Start/End: Original strand, 16 - 216
Target Start/End: Original strand, 12882118 - 12882319
Alignment:
| Q |
16 |
caagaacaagtacttttggaagctctttggccattgaattttaaggatttgtggtgtttgagaaagggatgaaattagcactctcatttggatgacactc |
115 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| | ||||||||||||||| |
|
|
| T |
12882118 |
caagaacaagtacttttggaaggtctttggccattgaattttaaggatttgtggtgtttgagaaagggatgaacttagcacttttatttggatgacactc |
12882217 |
T |
|
| Q |
116 |
aaaactgtggctagaaactcctcttaatta-ttctctgtatcacttgtcttccatgaagcaccaacacgtcttagattagaagtattccggtgtcggata |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||| | |||| | ||||||||||| ||||| |||||||||||| |
|
|
| T |
12882218 |
aaaactgtggctagaaactcctcttaattatttctctgtatcacttgacttccatgaagcgcgaacatgccttagattagacgtatttcggtgtcggata |
12882317 |
T |
|
| Q |
215 |
ca |
216 |
Q |
| |
|
|| |
|
|
| T |
12882318 |
ca |
12882319 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University