View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8661_high_18 (Length: 251)
Name: NF8661_high_18
Description: NF8661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8661_high_18 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 21466926 - 21467166
Alignment:
| Q |
1 |
tgagattggaaagttgacgaagctagcggnnnnnnncgcttggcagaacaaacttgaaggtagaattccatcagagttaggagattgtgtaagccttgag |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21466926 |
tgagattggaaagttgacgaagctgacggtttttttcgcttggcagaacaaacttgaaggtagaattccatcagagttaggagattgtgtaagccttgag |
21467025 |
T |
 |
| Q |
101 |
gctttggatttgtcttataattcactcagtgatagtttaccttcaggtctttttaagcttcaaaacttaacaaagcttttgttgatttctaatgatatct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21467026 |
gctttggatttgtcttataattcactcagtgatagtttaccttcaggtctttttaagcttcaaaacttaacaaagcttttgttgatttctaatgatatct |
21467125 |
T |
 |
| Q |
201 |
ctggctctattcctcatgagattggtaactgtagttctctg |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21467126 |
ctggctctattcctcatgagattggtaactgtagttctctg |
21467166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University