View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8661_high_24 (Length: 241)
Name: NF8661_high_24
Description: NF8661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8661_high_24 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 29 - 223
Target Start/End: Complemental strand, 19175828 - 19175623
Alignment:
| Q |
29 |
cgtgtatggtgtcagtgcttcataaaatttggcaacaagtaaaagacaagaaca-----------atgtagcaacaaacctacctagcactgggaggtgt |
117 |
Q |
| |
|
||||| |||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
19175828 |
cgtgtctggtgtcagtacttcataaaatttggcaacaagtaaaagacaagaacatgataagaacaatgtagcaacaaacctacctagcactgggaggtgt |
19175729 |
T |
|
| Q |
118 |
agtggggacttgaggtacaagctcaagaggcaaacccaagaaaccattaaacctatcaaaggtgacatgtgcaagatggcgcacgttagtagggtgacca |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
19175728 |
agtggggacttgaggtacaagctcaagaggcaaacccaagaaaccattaaacctatcaaaggtgacatgtgcaagatggcgcacattagtagggtgacca |
19175629 |
T |
|
| Q |
218 |
atttcc |
223 |
Q |
| |
|
|||||| |
|
|
| T |
19175628 |
atttcc |
19175623 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 145 - 207
Target Start/End: Complemental strand, 36405940 - 36405878
Alignment:
| Q |
145 |
aggcaaacccaagaaaccattaaacctatcaaaggtgacatgtgcaagatggcgcacgttagt |
207 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| || || || || | ||||||||||||||| |
|
|
| T |
36405940 |
aggcaaacccaagaaaccattgaacctatcaaaagtaacgtgagcgacatggcgcacgttagt |
36405878 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University