View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8661_high_31 (Length: 204)
Name: NF8661_high_31
Description: NF8661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8661_high_31 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 168; Significance: 3e-90; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 16 - 187
Target Start/End: Complemental strand, 34293843 - 34293672
Alignment:
| Q |
16 |
tcgtgttcatgctgtgagtcatcgatgtttgagttgaaacacgtcaattcaataggtgaccaaatgcttcaaatgcccatgtgttcctttttaaattgtc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34293843 |
tcgtgttcatgctgtgagtcatcgatgtttgagttgaaacacgtcaattcaataggtgaccaaatgcttcaaatgcccatgtgttcctttttaaattgtc |
34293744 |
T |
|
| Q |
116 |
acagacttatgtttttatctaaatatagcatagatgacctatttttgcggaaaactatatacatcaatgttc |
187 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34293743 |
acagacttatgttgttatctaaatatagcatagatgacctatttttgcggaaaactatatacatcaatgttc |
34293672 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 18 - 125
Target Start/End: Complemental strand, 34303860 - 34303748
Alignment:
| Q |
18 |
gtgttcatgctgtgagtcatcgatgtttgagttgaaacacgtcaattcaataggtgaccaaatgcttcaaatg-----cccatgtgttcctttttaaatt |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||| || |||||| || |||||||| || ||||||||||||||| ||||| |
|
|
| T |
34303860 |
gtgttcatgctgtgagtcatcgatgtttgagttgaaacaagtcaatttaacaggtgatcagatgcttcagttgcgtgtcccatgtgttcctttgcaaatt |
34303761 |
T |
|
| Q |
113 |
gtcacagacttat |
125 |
Q |
| |
|
|||| |||||||| |
|
|
| T |
34303760 |
gtcatagacttat |
34303748 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University