View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8661_low_23 (Length: 319)
Name: NF8661_low_23
Description: NF8661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8661_low_23 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 95; Significance: 2e-46; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 47 - 145
Target Start/End: Original strand, 13270359 - 13270457
Alignment:
| Q |
47 |
tatacctgaatcaaccttgtgatcagacttgacttcacttggtggagtagttagaaattgatgtgattcctcgtctagtaaatggtcagcaacactatc |
145 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
13270359 |
tatacctgaatcaaccttgtgatcagacttgacttcacttggtggagtagttagaaattgatgtggttcctcgtctagtaaatggtcagcaacactatc |
13270457 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 212 - 307
Target Start/End: Original strand, 13270524 - 13270619
Alignment:
| Q |
212 |
caaacgaccaaagaagtggcattttaatagtcatataagcccatagctttgttatacctgaagcttcgatttgaacattatccgtactaacaccaa |
307 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
13270524 |
caaacgaccaaagaagtggcattttaatagtcatataagcccatagctttgttatacctgaagcttccatttgaacattatccgtactaacaccaa |
13270619 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 47 - 125
Target Start/End: Original strand, 13261538 - 13261616
Alignment:
| Q |
47 |
tatacctgaatcaaccttgtgatcagacttgacttcacttggtggagtagttagaaattgatgtgattcctcgtctagt |
125 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||| |||||||||||| || ||||| | |||||| |||||| |
|
|
| T |
13261538 |
tatacctgaatcaaccttgtgatcggacttgacttcacttagtggagtagttaaaatttgatcgggttcctcatctagt |
13261616 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 47 - 86
Target Start/End: Original strand, 13262526 - 13262565
Alignment:
| Q |
47 |
tatacctgaatcaaccttgtgatcagacttgacttcactt |
86 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
13262526 |
tatacctgaatcaacattgtgatcagacttgacctcactt |
13262565 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University