View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8661_low_27 (Length: 311)
Name: NF8661_low_27
Description: NF8661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8661_low_27 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 32 - 311
Target Start/End: Original strand, 960032 - 960311
Alignment:
| Q |
32 |
ttgtggttttcaaacacttgtcatcatgatcctaagtgtgttttggttaaacatttgttaaacatgatttctaatcaattttattttgtaaaattgatta |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
960032 |
ttgtggttttcaaacacttgtcatcatgatcctaagtgtgttttagttaaacatttgttaaacatgatttctaatgaattttattttgtaaaattgatta |
960131 |
T |
 |
| Q |
132 |
attatatgattggattcactttctatgagaggtaaacatgattttagaattctaaacatgattttgtcatatgtgtgagtattcactttctataaatcat |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
960132 |
attatatgattggattcactttctatgagaggtaaacatgattttagaattctaaacatgattttgtcatatgtgtgagtattcactttccataaatcat |
960231 |
T |
 |
| Q |
232 |
acacgtaagatgagttctcctatctcaatcaatttttactatgtacgaagtttttaccattggttaacaatgattattaa |
311 |
Q |
| |
|
||| |||||||||||||||| ||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
960232 |
acatgtaagatgagttctcccatctcaatcgatttttactatgtacgaagtttttaccgttggttaacaatgattattaa |
960311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University