View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8661_low_31 (Length: 283)
Name: NF8661_low_31
Description: NF8661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8661_low_31 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 17 - 269
Target Start/End: Original strand, 20933845 - 20934097
Alignment:
| Q |
17 |
aacaaccatgtgtttctcattggctacatcaaacggtctttcaaaacaagcattggaaccacttacaataccttccatggagaaaatctctatttgaaca |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20933845 |
aacaaccatgtgtttctcattggctacatcaaacggtctttcaaaacaagcattggaaccacttacaataccttccatggagaaaatctctatttgaaca |
20933944 |
T |
 |
| Q |
117 |
tctaccaatgaagatactatctctatgtccttattattttctttgatagcaagaactacaaactttttcgtctttattgggaggccattgacctttcttt |
216 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20933945 |
tctaccaatgaagatactatctctatttccttattattttctttgatagcaagaactacaaactttttcgtctttattgggaggccattgacctttcttt |
20934044 |
T |
 |
| Q |
217 |
tctctttcttattgacccaaaagttcagtgttttccaccccacataagcagta |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20934045 |
tctctttcttattgacccaaaagttcagtgttttccaccccacataagcagta |
20934097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University