View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8661_low_32 (Length: 277)
Name: NF8661_low_32
Description: NF8661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8661_low_32 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 1 - 264
Target Start/End: Original strand, 6971283 - 6971546
Alignment:
| Q |
1 |
agggagacttgtagagagagttgtgtggaggataaatttatttactaacgccctatagatacaattatatattaatatttggtgggtgatcagtaaaaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
6971283 |
agggagacttgtagagagagttgtgtggaggataaatttatttactaacgccctatagatacaattatatattaatatttggtgggtgattagtaaaaac |
6971382 |
T |
|
| Q |
101 |
ctctataaacagtctttaaatcttgaggtcagctctaattttgacgagccctgaaaatccaactcacctaaactttatattagaatgatgttttttatat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||| ||| |||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
6971383 |
ctctataaacagtctttaaatcttgaggtcagctctgattttgatgagtcctgaaaatccaactcacctaaactttatattagaatgatattttttatat |
6971482 |
T |
|
| Q |
201 |
tagtgcttataaatatggccccatagagagggagagagattgtgtgcatgtattaaatgatgat |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
6971483 |
tagtgcttataaatatggccccatagagagggagagagattgtgtgcatgtattaaataatgat |
6971546 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University