View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8661_low_33 (Length: 275)
Name: NF8661_low_33
Description: NF8661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8661_low_33 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 146; Significance: 6e-77; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 146; E-Value: 6e-77
Query Start/End: Original strand, 106 - 255
Target Start/End: Original strand, 42956093 - 42956242
Alignment:
| Q |
106 |
ctgaaacacaatgaattaagatagtgatagcctaaagtgttcacaacttttgagaattcaactctcgcaggtatctagatttaccggtcaagcaatgcaa |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42956093 |
ctgaaacacaatgaattaagatagtgatagcctaaagtgttcacaacttttgagaattcaactctcgcaggtatctagatttaccggtcaagcaatgcaa |
42956192 |
T |
|
| Q |
206 |
aaaattggatctaggaaccaccttggttaacaagttagctcgattgtctt |
255 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42956193 |
aaaattggatctgggaaccaccttggttaacaagttagctcgattgtctt |
42956242 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 1 - 79
Target Start/End: Original strand, 42956017 - 42956095
Alignment:
| Q |
1 |
agatgttatcgcaacagcttttataaaaaacataagcaaaaactaacttggtaaattgtaaacacaattaatgatcctg |
79 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||| |||||||| |
|
|
| T |
42956017 |
agatgttatcgcaacagcttttataaaaaacataggcaaaatctaacttggtaaattgtaaacacaattagtgatcctg |
42956095 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University