View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8661_low_38 (Length: 259)
Name: NF8661_low_38
Description: NF8661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8661_low_38 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 21 - 259
Target Start/End: Original strand, 45794629 - 45794867
Alignment:
| Q |
21 |
tcttgaatattggtcacgcggcgttcccaaacatgtcgaaccaacaagacttttatcactgattttgccttgttctgctatgatggtgcagttttggatc |
120 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45794629 |
tcttgaatattggtcacgcggagttcccaaacatgtcgaaccaacaagacttttatcattgattttgccttgttctgctatgatggtgcagttttggatc |
45794728 |
T |
|
| Q |
121 |
acaagtccagttttctcatatttgtctagtcttgattgaacactcaccacattttttctcagagctaagctagaagaatttcgatgcttcacaattattt |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
45794729 |
acaagtccagttttctcatatttgtctagtcttgattgaacactcaccacattttttctcagagctaagctagaagaatttcggtgcttcacaattattt |
45794828 |
T |
|
| Q |
221 |
gcgagttttgaattatagttgctgagtctcctttgatga |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45794829 |
gcgagttttgaattatagttgctgagtctcctttgatga |
45794867 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University