View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8661_low_50 (Length: 242)
Name: NF8661_low_50
Description: NF8661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8661_low_50 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 25486575 - 25486798
Alignment:
| Q |
1 |
ggatgtgcttggatttttctagttaggtgcttgaaggaagtgggttccaacnnnnnnnnnnnctccttttgtatgtattgtgttctctaaaaattgaact |
100 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
25486575 |
ggatgtgcttggatttttctagctaggtgcttgaaggaagtgggttccaacttttttttt--ctccttttgtatgtattttgttctcgaaaaattgaact |
25486672 |
T |
|
| Q |
101 |
atattagtgaaaaaggggagttttagttcaagatttttgtgaagtaatacttgcttgagtgaataatgttcaattgttattgtatttcttaaggttgtca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
25486673 |
atattagtgaaaaaggggagttttagttcaagatttttgtgaagtaatacttgcttgagtgaatattgttcaattgttattgtatttcttaaggttgtca |
25486772 |
T |
|
| Q |
201 |
atttcactcttgttttatgaatattg |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
25486773 |
atttcactcttgttttatgaatattg |
25486798 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University