View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8661_low_59 (Length: 234)
Name: NF8661_low_59
Description: NF8661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8661_low_59 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 13 - 215
Target Start/End: Complemental strand, 18098068 - 18097866
Alignment:
| Q |
13 |
gagatgaagcaatatatgcaaatgtgacacaaacaatgattgcactaacaagctttcatgaactataataatataaatccaattgaaaattatagcacat |
112 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18098068 |
gagatgaagcgatatatgcaaatgtgacacaaacaatgattgcactaacaagctttcatgaactataataatataaatccaattgaaaattatagcacat |
18097969 |
T |
|
| Q |
113 |
gattttgtacgaactctatgggggcagctacacacttgtttactcattttaagtcactcacttacaagtgaaaatctttacacttactatgtgatgtaag |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18097968 |
gattttgtacgaactctatgggggcagctacacacttgtttactcattttaagtcactcacttacaagtgaaaatctttacacttactatgtgatgtaag |
18097869 |
T |
|
| Q |
213 |
aca |
215 |
Q |
| |
|
||| |
|
|
| T |
18097868 |
aca |
18097866 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University