View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8661_low_60 (Length: 234)
Name: NF8661_low_60
Description: NF8661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8661_low_60 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 39963821 - 39964048
Alignment:
| Q |
1 |
aatcaacaaaaaataaataacacaccaacggaacgctaaaccccagacatgaaaggggaggttagagagggaaaggtagctacttgtgtcaacgatgtcg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| ||||||| ||| ||||||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
39963821 |
aatcaacaaaaaataaataacacaccaaaggaacgataaaccctagaaatgaaaggggaagttagagagggaaagggagttacttgtgtcaacgatgtcg |
39963920 |
T |
|
| Q |
101 |
cggtgagctgcaacgtcgtcgagggattgaggacgatacttttcaacccatagcgaagctttgccaccgaaggaagggttaccggcggcaatgacggttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39963921 |
cggtgagctgcaacgtcgtcgagggattgaggacgatacttttcaacccatagcgaagctttgccaccgaaggaagggttaccggcggcaatgacggttt |
39964020 |
T |
|
| Q |
201 |
tgcccttgtctgtaacgttgatgtccat |
228 |
Q |
| |
|
||||||||||||| |||| ||||||||| |
|
|
| T |
39964021 |
tgcccttgtctgtgacgtcgatgtccat |
39964048 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University