View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8661_low_63 (Length: 222)
Name: NF8661_low_63
Description: NF8661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8661_low_63 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 116; Significance: 4e-59; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 1 - 132
Target Start/End: Original strand, 11071277 - 11071407
Alignment:
| Q |
1 |
tatagacttagttatcttaaactactccttcctaaaccctcttaaaccccaaacaggtcgagttatttggaattttcgaatcaaggttctagcatagaat |
100 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
11071277 |
tatagacttagttatgttaaactcctccttcctaaaccctcttaaaccccaaacaggtcgagt-atttggaattttcgaatcaaggttctagcatagaat |
11071375 |
T |
 |
| Q |
101 |
atacatggaagatttgtcatttttgtagaggc |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
11071376 |
atacatggaagatttgtcatttttgtagaggc |
11071407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 194 - 222
Target Start/End: Original strand, 11071469 - 11071497
Alignment:
| Q |
194 |
taggaaactaaaagaaatgctacggaaca |
222 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
11071469 |
taggaaactaaaagaaatgctacggaaca |
11071497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University