View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8661_low_64 (Length: 221)
Name: NF8661_low_64
Description: NF8661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8661_low_64 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 24 - 207
Target Start/End: Complemental strand, 39468706 - 39468523
Alignment:
| Q |
24 |
aaacttacagctgaccatccatcaggtgtgttcttcagtatttgcacaggcctgcattaataaaattccatatccatagtcatcaataataataaaaaca |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39468706 |
aaacttacagctgaccatccatcaggtgtgttcttcagtatttgcacaggcctgcattaataaaattccatatccatagtcatcaataataataaaaaca |
39468607 |
T |
|
| Q |
124 |
aagagattaattcatatacacagacgttgtaaaactttataattacttacgtgtcaaccgggcaaagcaacatacattcatctc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39468606 |
aagagattaattcatatacacagacgttgtaaaactttataattacttacgtgtcaaccgggcaaagcaacatacattcatctc |
39468523 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University