View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8661_low_66 (Length: 215)
Name: NF8661_low_66
Description: NF8661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8661_low_66 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 51 - 194
Target Start/End: Complemental strand, 6227310 - 6227167
Alignment:
| Q |
51 |
ataacaaactacgatttattagtagatggaatatatatagataaaagtccaatattagaaacccttataccattctcattcttattcatcgctctcacac |
150 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6227310 |
ataacaaactacgatttatttgtagatggaatatatatagataaaagtccaatattagaaacccttataccattctcattcttattcatcgctctcacac |
6227211 |
T |
|
| Q |
151 |
agaataacgctcacaaccacagtcttttgtttgtttagttttat |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6227210 |
agaataacgctcacaaccacagtcttttgtttgtttagttttat |
6227167 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University