View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8661_low_68 (Length: 211)
Name: NF8661_low_68
Description: NF8661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8661_low_68 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 17 - 197
Target Start/End: Original strand, 3810827 - 3811007
Alignment:
| Q |
17 |
tcaccctctacttggttggatcctgtattttcttggttcttttgcattttgctcaattgcaattaatatctttcttctaccaatgttaccagttttggta |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3810827 |
tcaccctctacttggttggatcctgtattttcttggttcttttgcattttgctcaattgcaattaatatctttcttctaccaatgttaccagttttggta |
3810926 |
T |
|
| Q |
117 |
ccttggcttgggattcttggagtcctaatggttatggcatttccttggtatcctgatggaatagtaagagctatgtctgtg |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3810927 |
ccttggcttgggattcttggagtcctaatggttatggcatttccttggtatcctgatggaatagtaagagctatgtctgtg |
3811007 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 87 - 188
Target Start/End: Complemental strand, 41672655 - 41672554
Alignment:
| Q |
87 |
tttcttctaccaatgttaccagttttggtaccttggcttgggattcttggagtcctaatggttatggcatttccttggtatcctgatggaatagtaagag |
186 |
Q |
| |
|
|||||||| ||| ||||||| ||| || | || ||| |||| ||| ||||||| |||| || ||||| |||||||||||||| ||||| ||||||||| |
|
|
| T |
41672655 |
tttcttcttccagtgttaccggttctgatgccgtggtttggtattattggagttttaattgtcatggcgtttccttggtatccggatggggtagtaagag |
41672556 |
T |
|
| Q |
187 |
ct |
188 |
Q |
| |
|
|| |
|
|
| T |
41672555 |
ct |
41672554 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University