View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8661_low_70 (Length: 204)
Name: NF8661_low_70
Description: NF8661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8661_low_70 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 136; Significance: 4e-71; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 22 - 186
Target Start/End: Complemental strand, 55271596 - 55271436
Alignment:
| Q |
22 |
attgattgcatgcttaaaatacatatataccatcatcatattcatattcatgtcttggatatggttctttcaggttttatactgaggctcttgggatgaa |
121 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55271596 |
attgattgcatgcttaaaatacata----ccatcatcatattcatattcatgtcttggatatggttctttcaggttttatactgaggctcttgggatgaa |
55271501 |
T |
|
| Q |
122 |
acttttgaggcagagagatgttcctgaggagaaatatgccaacgcttttgttggatttggtgatg |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||| |||| |
|
|
| T |
55271500 |
acttttgaggcagagagatgttcctgaggagaaatatgccaatgcttttcttggatttggcgatg |
55271436 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 130; E-Value: 1e-67
Query Start/End: Original strand, 57 - 186
Target Start/End: Complemental strand, 55265660 - 55265531
Alignment:
| Q |
57 |
tcatattcatattcatgtcttggatatggttctttcaggttttatactgaggctcttgggatgaaacttttgaggcagagagatgttcctgaggagaaat |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55265660 |
tcatattcatattcatgtcttggatatggttctttcaggttttatactgaggctcttgggatgaaacttttgaggcagagagatgttcctgaggagaaat |
55265561 |
T |
|
| Q |
157 |
atgccaacgcttttgttggatttggtgatg |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
55265560 |
atgccaacgcttttgttggatttggtgatg |
55265531 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 47; Significance: 5e-18; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 91 - 181
Target Start/End: Complemental strand, 8303053 - 8302963
Alignment:
| Q |
91 |
tcaggttttatactgaggctcttgggatgaaacttttgaggcagagagatgttcctgaggagaaatatgccaacgcttttgttggatttgg |
181 |
Q |
| |
|
|||||||||| ||||| ||| |||| ||||| ||||||||| | ||||||||||| ||||||||||| ||||| |||||| |||||||||| |
|
|
| T |
8303053 |
tcaggttttacactgaagcttttggaatgaagcttttgaggaaaagagatgttccagaggagaaatacgccaatgcttttcttggatttgg |
8302963 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University