View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8662_low_13 (Length: 293)
Name: NF8662_low_13
Description: NF8662
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8662_low_13 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 18 - 287
Target Start/End: Original strand, 17357829 - 17358098
Alignment:
| Q |
18 |
taaacaagatctcatgttcaagtgttgtaaataaaataaacgtgattgaaaagagggaccacctattttgttgagtagagattaattattaacaaagtcg |
117 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||| |||||| ||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
17357829 |
taaacaagatctcatgttcgagtgttgtaaataaaataaacgtgattgagaagaggaaccacctattttgttgactagagattaattattaacaaagtcg |
17357928 |
T |
|
| Q |
118 |
atagttctcacaataacatcgttaccaaaaacaaacaaaaattacgctcaaccgacaaatcaatgttagtagtagnnnnnnngtatgttaataatttcaa |
217 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
17357929 |
atagttctcacaacaacatcgttaccaaaaacaaacaaaaattacgctcaaccgacaaatcaatgttagtagtagtttttttgtatgttaataatttcaa |
17358028 |
T |
|
| Q |
218 |
atcaatgtctaaatattgaacatttttaatttgatcagaaagacaaagcttccatactgataacaccaaa |
287 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
17358029 |
atcaatgtctaaatattgaacattttaaatttgatcagaaagacaaagcttccatactgataacagcaaa |
17358098 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University