View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8663_high_17 (Length: 228)
Name: NF8663_high_17
Description: NF8663
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8663_high_17 |
 |  |
|
| [»] chr6 (2 HSPs) |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 173; Significance: 4e-93; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 5569686 - 5569924
Alignment:
| Q |
1 |
atacatgctctaaattagaaggaaaaatgataacccagtccccaactaaaattactcttaacctagcctctcaaaattagttttcatctatgaagcacgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
5569686 |
atacatgctctaaattagaaggaaaaatgataacccagtccccaactaaaattaatcttaacctagcctgtcaaaattagttttcatctatgaagcacgg |
5569785 |
T |
 |
| Q |
101 |
atacggatacacactggacatgacacaaacaccgatacggacacctgaacacgcttaa-----------tccgtgcttcatagattttcatgagtcaaag |
189 |
Q |
| |
|
||||||| ||||||||||||||||||| |||||||||| ||||||||||||||| ||| |||||||||||| |||||||||||||||||| |
|
|
| T |
5569786 |
atacggacacacactggacatgacacagacaccgatacagacacctgaacacgcctaatctgaggagtgtccgtgcttcatcgattttcatgagtcaaag |
5569885 |
T |
 |
| Q |
190 |
ttggagcattgtgattgaaatctaactcaaactgcaaac |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5569886 |
ttggagcattgtgattgaaatctaactcaaactgcaaac |
5569924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 177 - 228
Target Start/End: Original strand, 2498074 - 2498125
Alignment:
| Q |
177 |
tcatgagtcaaagttggagcattgtgattgaaatctaactcaaactgcaaac |
228 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |||||||||||||||| |
|
|
| T |
2498074 |
tcatgagtcaaagtatgagcattgtgattgaaatccaactcaaactgcaaac |
2498125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 177 - 228
Target Start/End: Original strand, 27100662 - 27100713
Alignment:
| Q |
177 |
tcatgagtcaaagttggagcattgtgattgaaatctaactcaaactgcaaac |
228 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |||||||||||||||| |
|
|
| T |
27100662 |
tcatgagtcaaagtatgagcattgtgattgaaatccaactcaaactgcaaac |
27100713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University