View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8663_high_8 (Length: 286)
Name: NF8663_high_8
Description: NF8663
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8663_high_8 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 170; Significance: 3e-91; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 38 - 268
Target Start/End: Original strand, 21898119 - 21898361
Alignment:
| Q |
38 |
aaaaggttcacgggatacgtgtgtagatagggtggaggggaatgg------------agaatggagaggttgaaagagggaagggaggtccatgccttgg |
125 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21898119 |
aaaaggttcacgagatatgtgtgtagatagggtggaggggaatggagattgtgatggagaatggagaggttgaaagagggaagggaggtccatgccttgg |
21898218 |
T |
|
| Q |
126 |
aagtattaccatgtaaagtggtgttggattagtttgagtacaattttgtgggtgttttaccttttcgtattgaactgaaagtgttgcacacttcaatctt |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| || ||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
21898219 |
aagtattaccatgtaaagtggtgttggattagttggagtacaattttgtgggtgttttagctattcgtattgaactgaaagtgttgcagacttcaatctt |
21898318 |
T |
|
| Q |
226 |
tatggagggttggaatggcatcaaggtgtatgctatgggggtc |
268 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
21898319 |
tatggagggttggaatggcatcaagatgtatgccatgggggtc |
21898361 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University