View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8663_low_18 (Length: 252)
Name: NF8663_low_18
Description: NF8663
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8663_low_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 70; Significance: 1e-31; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 78
Target Start/End: Complemental strand, 25993776 - 25993699
Alignment:
| Q |
1 |
taaatgaatgacttggaaattaggccaattttaaaatgttagctttatggtatgtatgaatgaatggctttttgtgtc |
78 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
25993776 |
taaatgaatgacttggaaatttggccaattttaaaatgttagctttatggtatgtatgaatgaatgactttttgtgtc |
25993699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 172 - 248
Target Start/End: Complemental strand, 25993605 - 25993529
Alignment:
| Q |
172 |
taattttatggtatgattgaccgtttgtgtatgtagtgtccaaaataaacatatctatctaactttctgctactgca |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
25993605 |
taattttatggtatgattgaccgtttgtgtatgtagtgtccaaaatgaacataactatctaactttctgctactgca |
25993529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 1 - 78
Target Start/End: Complemental strand, 25989675 - 25989598
Alignment:
| Q |
1 |
taaatgaatgacttggaaattaggccaattttaaaatgttagctttatggtatgtatgaatgaatggctttttgtgtc |
78 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
25989675 |
taaatgaatgacttggaaatttggccaattttaaaacgttagttttatggtatgtatgaatgaatgactttttgtgtc |
25989598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 172 - 250
Target Start/End: Complemental strand, 25989513 - 25989435
Alignment:
| Q |
172 |
taattttatggtatgattgaccgtttgtgtatgtagtgtccaaaataaacatatctatctaactttctgctactgcact |
250 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |||||||||||| ||||||||||||||||||| ||| |||||||| |
|
|
| T |
25989513 |
taattttatggtatgattgaccatttgtgtatgcagtgtccaaaatgaacatatctatctaactttatgcaactgcact |
25989435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 172 - 248
Target Start/End: Complemental strand, 4571093 - 4571017
Alignment:
| Q |
172 |
taattttatggtatgattgaccgtttgtgtatgtagtgtccaaaataaacatatctatctaactttctgctactgca |
248 |
Q |
| |
|
||||||||||||||| ||||| |||||||||| |||||||||||| |||| | |||| | |||||||||||||| |
|
|
| T |
4571093 |
taattttatggtatggttgactatttgtgtatgcagtgtccaaaatgaacacaaaaatctgagtttctgctactgca |
4571017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University