View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8663_low_21 (Length: 240)
Name: NF8663_low_21
Description: NF8663
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8663_low_21 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 96; Significance: 3e-47; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 125 - 224
Target Start/End: Original strand, 26613013 - 26613112
Alignment:
| Q |
125 |
gttgtttaagttaattcgttcccagctaaattttttaagtttgtaaatgtttgcatcgttgctcttttattcacctttactaatctttaactttgttgtt |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26613013 |
gttgtttaagttaattcgttcccagctaaattttttaagtttgtaaatgtttgcatcattgctcttttattcacctttactaatctttaactttgttgtt |
26613112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 1 - 53
Target Start/End: Original strand, 26612883 - 26612935
Alignment:
| Q |
1 |
ttttaatgtttctttaagagtattgctagaaagtaaaatgtgtttgttgttat |
53 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
26612883 |
ttttaatgtttctttaagagtattgttagaaagtaaaatgtgtttgttgttat |
26612935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University