View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8663_low_23 (Length: 234)
Name: NF8663_low_23
Description: NF8663
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8663_low_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 24171670 - 24171886
Alignment:
| Q |
1 |
atcgaggaaaattatatctgagattttgtatttcttgaatccacttagtttgtttggtagaacggttatgtttgctggtagctcgtgtgaatcccaatct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24171670 |
atcgaggaaaattatatctgagattttgtatttcttgaatccgcttagtttgtttggtagaacggttatgtttgctggtagctcgtgtgaatcccaatct |
24171769 |
T |
 |
| Q |
101 |
tgtgattttggttcgtcggcgaacgcggttgatggtgagagaattctcgaccagaaatcacctccttcgccgccgttgttaaaccaaccaccacctccac |
200 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||| || ||||||||||||||||| ||||||||||||| |
|
|
| T |
24171770 |
tgtgattttggttcgtcggcgaaagcggttgatggtgagagaattcttgaccagaaatcacctccgtcaccgccgttgttaaaccatccaccacctccac |
24171869 |
T |
 |
| Q |
201 |
caccggaggaagatcct |
217 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
24171870 |
caccggaggaagatcct |
24171886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University