View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8663_low_27 (Length: 216)

Name: NF8663_low_27
Description: NF8663
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8663_low_27
NF8663_low_27
[»] chr8 (1 HSPs)
chr8 (89-212)||(34098639-34098762)


Alignment Details
Target: chr8 (Bit Score: 116; Significance: 3e-59; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 116; E-Value: 3e-59
Query Start/End: Original strand, 89 - 212
Target Start/End: Complemental strand, 34098762 - 34098639
Alignment:
89 cctagacgaatttctcagtttgtggcggtcgaagatcaactccggcagcgctttccggtgagattttgcttttcacggccacgttgagcttagtgcttct 188  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34098762 cctagacgaatttctcagtttgtggcggtcgaagatcaactccggcagcgctttccggtgagattttgcttttcacggccacgttgagcttagtgcttct 34098663  T
189 ccgattgaacttgtctctgctact 212  Q
    |||||||||||||| |||| ||||    
34098662 ccgattgaacttgtttctgatact 34098639  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University