View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8663_low_27 (Length: 216)
Name: NF8663_low_27
Description: NF8663
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8663_low_27 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 116; Significance: 3e-59; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 116; E-Value: 3e-59
Query Start/End: Original strand, 89 - 212
Target Start/End: Complemental strand, 34098762 - 34098639
Alignment:
| Q |
89 |
cctagacgaatttctcagtttgtggcggtcgaagatcaactccggcagcgctttccggtgagattttgcttttcacggccacgttgagcttagtgcttct |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34098762 |
cctagacgaatttctcagtttgtggcggtcgaagatcaactccggcagcgctttccggtgagattttgcttttcacggccacgttgagcttagtgcttct |
34098663 |
T |
 |
| Q |
189 |
ccgattgaacttgtctctgctact |
212 |
Q |
| |
|
|||||||||||||| |||| |||| |
|
|
| T |
34098662 |
ccgattgaacttgtttctgatact |
34098639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University