View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8664_low_11 (Length: 201)
Name: NF8664_low_11
Description: NF8664
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8664_low_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 63; Significance: 1e-27; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 124 - 186
Target Start/End: Original strand, 2693881 - 2693943
Alignment:
| Q |
124 |
gcttaacccaccattgatgaatatcaaaatcaaaacctagtttttgagcttccgaccaccaaa |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2693881 |
gcttaacccaccattgatgaatatcaaaatcaaaacctagtttttgagcttccgaccaccaaa |
2693943 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 28 - 57
Target Start/End: Original strand, 2693781 - 2693810
Alignment:
| Q |
28 |
ctatttcataaatgattttgtatgatgcat |
57 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
2693781 |
ctatttcataaatgattttgtatgatgcat |
2693810 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University