View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8666_low_2 (Length: 417)
Name: NF8666_low_2
Description: NF8666
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8666_low_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 390; Significance: 0; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 390; E-Value: 0
Query Start/End: Original strand, 1 - 402
Target Start/End: Original strand, 38801634 - 38802035
Alignment:
| Q |
1 |
tgacgctgacacgggagatgaatacaataatgagatgattgatgaagacgacgatgattttcatgagaatcgcgtcatagaggtgagatggagggaagct |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38801634 |
tgacgctgacacgggggatgaatacaataatgagatgattgatgaagacgacgatgattttcatgagaatcgcgtcatagaggtgagatggagggaagct |
38801733 |
T |
 |
| Q |
101 |
ctagatggattggatcacttgcagatacttgggcaacatggaacagctggtggccttatagatgtgtctgctgaaccttttgaaggggttaatgtggatg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
38801734 |
ctagatggattggatcacttgcagatacttgggcaacatagaacagctggtggccttatagatttgtctgctgaaccttttgaaggggttaatgtggatg |
38801833 |
T |
 |
| Q |
201 |
acctttttcgtcttcagagttttgaacgtcgtcgccaaacaggtaggtcttccttcgagaggcctgcttctgaaataaatggttttcaacatcctctttt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38801834 |
acctttttcgtcttcagagttttgaacgtcgtcgccaaacaggtaggtcttccttcgagaggcctgcttctgaaataaatggttttcaacatcctctttt |
38801933 |
T |
 |
| Q |
301 |
tgtaaggccaccacaatctggcgattttgtctctatgtggtcatctggtggtaattctgcatcccgagattcagaaaccctgtcatctgggaatcttgat |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38801934 |
tgtaaggccaccacaatctggcgattttgtctctatgtggtcatctggtggtaattctgcatcccgagattcagaaaccctgtcatctgggaatcttgat |
38802033 |
T |
 |
| Q |
401 |
gt |
402 |
Q |
| |
|
|| |
|
|
| T |
38802034 |
gt |
38802035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 18 - 395
Target Start/End: Original strand, 38780447 - 38780824
Alignment:
| Q |
18 |
atgaatacaataatgagatgattgatgaagacgacgatgattttcatgagaatcgcgtcatagaggtgagatggagggaagctctagatggattggatca |
117 |
Q |
| |
|
||||||||| | || | ||||||||||||||||||||||||||||||||||||| | |||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
38780447 |
atgaatacattgatcaaatgattgatgaagacgacgatgattttcatgagaatcacatcattgaggtgagatggagggaagctcttgatggattggatca |
38780546 |
T |
 |
| Q |
118 |
cttgcagatacttgggcaacatggaacagctggtggccttatagatgtgtctgctgaaccttttgaaggggttaatgtggatgacctttttcgtcttcag |
217 |
Q |
| |
|
||| |||||||||||||||| |||||| | |||||||||||| |||||| ||| |||||||||||| |||||| ||| |||||| ||||||||||||| |
|
|
| T |
38780547 |
cttccagatacttgggcaacctggaactggtggtggccttatggatgtggttgccgaaccttttgaacgggttactgttgatgacttttttcgtcttcaa |
38780646 |
T |
 |
| Q |
218 |
agttttgaacgtcgtcgccaaacaggtaggtcttccttcgagaggcctgcttctgaaataaatggttttcaacatcctctttttgtaaggccaccacaat |
317 |
Q |
| |
|
|||||||||||||| ||||| |||||||| |||||||||||||| ||| ||||||||||||||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
38780647 |
agttttgaacgtcgccgccagacaggtagatcttccttcgagagatctgtttctgaaataaatggttttcaacatcctcttcttgtaaggccaccgcaat |
38780746 |
T |
 |
| Q |
318 |
ctggcgattttgtctctatgtggtcatctggtggtaattctgcatcccgagattcagaaaccctgtcatctgggaatc |
395 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| |||||||||||| ||||| ||||||| |||||||||||||| |
|
|
| T |
38780747 |
ctggcgattttgtctctatgtggtcatcaggtggtatttctgcatcccgggattcggaaacccagtcatctgggaatc |
38780824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University