View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8666_low_7 (Length: 255)
Name: NF8666_low_7
Description: NF8666
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8666_low_7 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 1 - 171
Target Start/End: Complemental strand, 29024720 - 29024550
Alignment:
| Q |
1 |
tttctgaagaagattttgttgctcaaataattgcgcaaattctacctgcttttgattatatgactgatgaaaattattttgctgaagaaccattagttga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29024720 |
tttctgaagaagattttgttgctcaaataattgtgcacgttctaccttcttttcattatatgactgatgaaaattattttgctgaagaaccattagttga |
29024621 |
T |
|
| Q |
101 |
tgatgataatgatgtcgctgaagaacttgttgttgaagaggaagacatggatgatgatagtagcaactcaa |
171 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29024620 |
tgatgataatgatgtcgctgaagaacttgttgttgaagaggaagacatggatgatgatagtagcaactcaa |
29024550 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 99 - 171
Target Start/End: Complemental strand, 36067288 - 36067216
Alignment:
| Q |
99 |
gatgatgataatgatgtcgctgaagaacttgttgttgaagaggaagacatggatgatgatagtagcaactcaa |
171 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||||||| | | |||||||||||||||||||||| |
|
|
| T |
36067288 |
gatgatgataatgatgttgctgatgaacttgttgttgaagaggataatagtgatgatgatagtagcaactcaa |
36067216 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University